CDNF cDNA ORF Clone, Human, C-Myc tag

Cat: HG15691-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CDNF Reagents
CRO Services
Product recommended

All CDNF Reagents
CDNF cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
564 bp
Description
Full length Clone DNA of Human cerebral dopamine neurotrophic factor with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CDNF cDNA ORF Clone, Human, C-Myc tag Alternative Names
ARMETL1 cDNA ORF Clone, Human
CDNF Background Information

Cerebral Dopamine Neurotrophic Factor (CDNF), also known as ARMETL1 (ARMET-like protein 1), is a secreted protein with eight conserved cysteine residues, predicting a unique protein fold and defining a new, evolutionarily conserved protein family. CDNF is a novel neurotrophic factor with strong trophic activity on dopaminergic neurons comparable to that of glial cell line-derived neurotrophic factor (GDNF). CDNF/ARMETL1 is a evolutionary conserved protein which can protect and restore the function of dopaminergic neurons in the rat model of Parkinson's disease, suggesting that CDNF might be beneficial for the treatment of Parkinson's disease. CDNF is widely expressed in neurons in several brain regions including cerebral cortex, hippocampus, substantia nigra, striatum and cerebellum. Human CDNF is glycosylated and secreted from transiently transfected cells. CDNF promotes the survival, growth, and function of dopamine-specific neurons and is expressed in brain regions that undergo cocaine-induced neuroplasticity.

Full Name
cerebral dopamine neurotrophic factor
References
  • Choi JM, et al. (2011) Analysis of mutations and the association between polymorphisms in the cerebral dopamine neurotrophic factor (CDNF) gene and Parkinson disease. Neurosci Lett. 493(3): 97-101.
  • Sun ZP, et al. (2011) Intracellular trafficking and secretion of cerebral dopamine neurotrophic factor in neurosecretory cells. J Neurochem. 117(1): 121-32.
  • Lohoff FW, et al. (2009) Association analysis between polymorphisms in the conserved dopamine neurotrophic factor (CDNF) gene and cocaine dependence. Neurosci Lett. 453(3): 199-203.
  • Lindholm P, et al. (2007) Novel neurotrophic factor CDNF protects and rescues midbrain dopamine neurons in vivo. Nature. 448(7149): 73-7.
  • CDNF cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CDNF cDNA ORF Clone in Cloning Vector, Mouse MG50569-M
    CDNF cDNA ORF Clone, Mouse, untagged MG50569-UT
    CDNF Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50569-ACGLN
    CDNF cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50569-ACG
    CDNF cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50569-ACR
    CDNF cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50569-CF
    CDNF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50569-NF
    CDNF cDNA ORF Clone, Mouse, C-His tag MG50569-CH
    CDNF cDNA ORF Clone, Mouse, N-His tag MG50569-NH
    CDNF cDNA ORF Clone, Mouse, C-HA tag MG50569-CY
    CDNF cDNA ORF Clone, Mouse, N-HA tag MG50569-NY
    CDNF cDNA ORF Clone, Mouse, C-Myc tag MG50569-CM
    CDNF cDNA ORF Clone, Mouse, N-Myc tag MG50569-NM
    CDNF qPCR Primer Pairs, Mouse MP200561

    CDNF cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CDNF cDNA ORF Clone in Cloning Vector, Human HG15691-G
    CDNF cDNA ORF Clone, Human, untagged HG15691-UT
    CDNF cDNA ORF Clone, Human, C-GFPSpark® tag HG15691-ACG
    CDNF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15691-ACGLN
    CDNF cDNA ORF Clone, Human, C-OFPSpark® tag HG15691-ACR
    CDNF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15691-CF
    CDNF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15691-NF
    CDNF cDNA ORF Clone, Human, C-His tag HG15691-CH
    CDNF cDNA ORF Clone, Human, N-His tag HG15691-NH
    CDNF cDNA ORF Clone, Human, C-HA tag HG15691-CY
    CDNF cDNA ORF Clone, Human, N-HA tag HG15691-NY
    CDNF cDNA ORF Clone, Human, N-Myc tag HG15691-NM
    CDNF qPCR Primer Pairs, Human HP104288
    info info
    添加购物车成功! 添加购物车失败!