CDKN2AIPNL cDNA ORF Clone, Human, untagged

Cat: HG14487-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CDKN2AIPNL Reagents
CRO Services
Product recommended

All CDKN2AIPNL Reagents
CDKN2AIPNL cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
351 bp
Description
Full length Clone DNA of Human CDKN2A interacting protein N-terminal like.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CDKN2AIPNL Background Information
Full Name
CDKN2A interacting protein N-terminal like

CDKN2AIPNL cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CDKN2AIPNL cDNA ORF Clone in Cloning Vector, Rat RG80992-U
CDKN2AIPNL cDNA ORF Clone, Rat, untagged RG80992-UT
CDKN2AIPNL Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80992-ACGLN
CDKN2AIPNL cDNA ORF Clone, Rat, C-GFPSpark® tag RG80992-ACG
CDKN2AIPNL cDNA ORF Clone, Rat, N-GFPSpark® tag RG80992-ANG
CDKN2AIPNL cDNA ORF Clone, Rat, C-OFPSpark® tag RG80992-ACR
CDKN2AIPNL cDNA ORF Clone, Rat, N-OFPSpark® tag RG80992-ANR
CDKN2AIPNL cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80992-CF
CDKN2AIPNL cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80992-NF
CDKN2AIPNL cDNA ORF Clone, Rat, C-His tag RG80992-CH
CDKN2AIPNL cDNA ORF Clone, Rat, N-His tag RG80992-NH
CDKN2AIPNL cDNA ORF Clone, Rat, C-HA tag RG80992-CY
CDKN2AIPNL cDNA ORF Clone, Rat, N-HA tag RG80992-NY
CDKN2AIPNL cDNA ORF Clone, Rat, C-Myc tag RG80992-CM
CDKN2AIPNL cDNA ORF Clone, Rat, N-Myc tag RG80992-NM
CDKN2AIPNL qPCR Primer Pairs, Rat RP300956

CDKN2AIPNL cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CDKN2AIPNL cDNA ORF Clone in Cloning Vector, Human HG14487-G
CDKN2AIPNL cDNA ORF Clone, Human, C-GFPSpark® tag HG14487-ACG
CDKN2AIPNL Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14487-ACGLN
CDKN2AIPNL cDNA ORF Clone, Human, N-GFPSpark® tag HG14487-ANG
CDKN2AIPNL cDNA ORF Clone, Human, C-OFPSpark® tag HG14487-ACR
CDKN2AIPNL cDNA ORF Clone, Human, N-OFPSpark® tag HG14487-ANR
CDKN2AIPNL cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14487-CF
CDKN2AIPNL cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14487-NF
CDKN2AIPNL cDNA ORF Clone, Human, C-His tag HG14487-CH
CDKN2AIPNL cDNA ORF Clone, Human, N-His tag HG14487-NH
CDKN2AIPNL cDNA ORF Clone, Human, C-HA tag HG14487-CY
CDKN2AIPNL cDNA ORF Clone, Human, N-HA tag HG14487-NY
CDKN2AIPNL cDNA ORF Clone, Human, C-Myc tag HG14487-CM
CDKN2AIPNL cDNA ORF Clone, Human, N-Myc tag HG14487-NM
CDKN2AIPNL qPCR Primer Pairs, Human HP103134
info info
添加购物车成功! 添加购物车失败!