Quick Order

Human CDK8 Gene ORF cDNA clone expression plasmid

  • Human CDK8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human CDK8 cDNA Clone Product Information
NCBI RefSeq:NM_001260.1
RefSeq ORF Size:1395bp
cDNA Description:Full length Clone DNA of Homo sapiens cyclin-dependent kinase 8.
Gene Synonym:K35, MGC126074, MGC126075, CDK8
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CDK8
Restriction Site:HindIII + XbaI (6.1kb + 1.4kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CDK8 qPCR primers for gene expression analysis, HP100655 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CDK8 Gene Plasmid Map
Human CDK8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"