CDK7 cDNA ORF Clone, Human, C-Myc tag

Cat: HG12293-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CDK7 Reagents
CRO Services
Product recommended

All CDK7 Reagents
CDK7 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1086 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human cyclin-dependent kinase 7 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
KpnI + NotI(6kb+1.09kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CDK7 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CDK7 cDNA ORF Clone, Human, C-Myc tag Validated Images
Human IL12A / IL-12A Gene Plasmid Map 5644
CDK7 cDNA ORF Clone, Human, C-Myc tag Alternative Names
CAK1 cDNA ORF Clone, Human;CDKN7 cDNA ORF Clone, Human;HCAK cDNA ORF Clone, Human;MO15 cDNA ORF Clone, Human;p39MO15 cDNA ORF Clone, Human;STK1 cDNA ORF Clone, Human
CDK7 Background Information
Full Name
cyclin-dependent kinase 7

CDK7 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
CDK7 cDNA ORF Clone in Cloning Vector, Rhesus CG90591-G
CDK7 cDNA ORF Clone, Rhesus, untagged CG90591-UT
CDK7 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90591-ACGLN
CDK7 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90591-ACG
CDK7 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90591-ANG
CDK7 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90591-ACR
CDK7 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90591-ANR
CDK7 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90591-CF
CDK7 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90591-NF
CDK7 cDNA ORF Clone, Rhesus, C-His tag CG90591-CH
CDK7 cDNA ORF Clone, Rhesus, N-His tag CG90591-NH
CDK7 cDNA ORF Clone, Rhesus, C-HA tag CG90591-CY
CDK7 cDNA ORF Clone, Rhesus, N-HA tag CG90591-NY
CDK7 cDNA ORF Clone, Rhesus, C-Myc tag CG90591-CM
CDK7 cDNA ORF Clone, Rhesus, N-Myc tag CG90591-NM

CDK7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CDK7 cDNA ORF Clone in Cloning Vector, Human HG12293-G
CDK7 cDNA ORF Clone, Human, untagged HG12293-UT
CDK7 cDNA ORF Clone, Human, C-GFPSpark® tag HG12293-ACG
CDK7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12293-ACGLN
CDK7 cDNA ORF Clone, Human, N-GFPSpark® tag HG12293-ANG
CDK7 cDNA ORF Clone, Human, C-OFPSpark® tag HG12293-ACR
CDK7 cDNA ORF Clone, Human, N-OFPSpark® tag HG12293-ANR
CDK7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12293-CF
CDK7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12293-NF
CDK7 cDNA ORF Clone, Human, C-His tag HG12293-CH
CDK7 cDNA ORF Clone, Human, N-His tag HG12293-NH
CDK7 cDNA ORF Clone, Human, C-HA tag HG12293-CY
CDK7 cDNA ORF Clone, Human, N-HA tag HG12293-NY
CDK7 cDNA ORF Clone, Human, N-Myc tag HG12293-NM
CDK7 qPCR Primer Pairs, Human HP101896
info info
添加购物车成功! 添加购物车失败!