p35/CDK5R1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10922-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All p35/CDK5R1 Reagents
CRO Services
Product recommended

All p35/CDK5R1 Reagents
p35/CDK5R1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
924 bp
Description
Full length Clone DNA of Human cyclin-dependent kinase 5, regulatory subunit 1 (p35) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

p35/CDK5R1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CDK5P35 cDNA ORF Clone, Human;CDK5R cDNA ORF Clone, Human;NCK5A cDNA ORF Clone, Human;p23 cDNA ORF Clone, Human;p25 cDNA ORF Clone, Human;p35 cDNA ORF Clone, Human;p35nck5a cDNA ORF Clone, Human
p35/CDK5R1 Background Information
Full Name
cyclin-dependent kinase 5, regulatory subunit 1 (p35)

p35/CDK5R1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
p35/CDK5R1 cDNA ORF Clone in Cloning Vector, Mouse MG51010-G
p35/CDK5R1 cDNA ORF Clone, Mouse, untagged MG51010-UT
p35/CDK5R1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51010-ACGLN
p35/CDK5R1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51010-ACG
p35/CDK5R1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51010-ANG
p35/CDK5R1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51010-ACR
p35/CDK5R1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51010-ANR
p35/CDK5R1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51010-CF
p35/CDK5R1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51010-NF
p35/CDK5R1 cDNA ORF Clone, Mouse, C-His tag MG51010-CH
p35/CDK5R1 cDNA ORF Clone, Mouse, N-His tag MG51010-NH
p35/CDK5R1 cDNA ORF Clone, Mouse, C-HA tag MG51010-CY
p35/CDK5R1 cDNA ORF Clone, Mouse, N-HA tag MG51010-NY
p35/CDK5R1 cDNA ORF Clone, Mouse, C-Myc tag MG51010-CM
p35/CDK5R1 cDNA ORF Clone, Mouse, N-Myc tag MG51010-NM
p35/CDK5R1 qPCR Primer Pairs, Mouse MP200970

p35/CDK5R1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
p35/CDK5R1 cDNA ORF Clone in Cloning Vector, Human HG10922-M
p35/CDK5R1 cDNA ORF Clone, Human, untagged HG10922-UT
p35/CDK5R1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10922-ACGLN
p35/CDK5R1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10922-ACG
p35/CDK5R1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10922-ANG
p35/CDK5R1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10922-ACR
p35/CDK5R1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10922-ANR
p35/CDK5R1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10922-CF
p35/CDK5R1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10922-NF
p35/CDK5R1 cDNA ORF Clone, Human, C-His tag HG10922-CH
p35/CDK5R1 cDNA ORF Clone, Human, N-His tag HG10922-NH
p35/CDK5R1 cDNA ORF Clone, Human, C-HA tag HG10922-CY
p35/CDK5R1 cDNA ORF Clone, Human, N-HA tag HG10922-NY
p35/CDK5R1 cDNA ORF Clone, Human, C-Myc tag HG10922-CM
p35/CDK5R1 qPCR Primer Pairs, Human HP100804
info info
添加购物车成功! 添加购物车失败!