Cdk5 cDNA ORF Clone, Human, N-His tag

Cat: HG10897-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cdk5 Reagents
CRO Services
Product recommended

All Cdk5 Reagents
Cdk5 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
879 bp
Description
Full length Clone DNA of Human cyclin-dependent kinase 5 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cdk5 cDNA ORF Clone, Human, N-His tag Alternative Names
PSSALRE cDNA ORF Clone, Human
Cdk5 Background Information

Cell division protein kinase 5, also known as Cyclin-dependent kinase 5, Serine/threonine-protein kinase PSSALRE, Tau protein kinase II catalytic subunit, TPKII catalytic subunit and CDK5, is a cytoplasm protein which belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family and CDC2 / CDKX subfamily. Cyclin-dependent kinases (Cdks) are a family of proline-directed Ser/Thr kinases known for their role in the control of cell cycle progression. In 1992, this family was joined by CDK5, which is an atypical member in that it uses its own activators and is multifunctional, playing important regulatory roles in multiple cellular functions. CDK5, unlike other Cdks, is not regulated by cyclins, and its activity is primarily detected in postmitotic neurons in developing and adult nervous systems. CDK5 is activated by association with a neuron-specific activator, p35 or its isoform p39. CDK5 is probably involved in the control of the cell cycle. It interacts with D1 and D3-type G1 cyclins. CDK5 can phosphorylate histone H1, tau, MAP2 and NF-H and NF-M. It also interacts with p35 which activates the kinase. CDK5 plays important roles in various neuronal activities, including neuronal migration, synaptic activity, and neuronal cell death.

Full Name
cyclin-dependent kinase 5
References
  • Smith,D.S. et al., 2001, Cell Growth Differ. 12 (6):277-83.
  • Mapelli,M. et al., 2003, Neurosignals.  12 (4-5):164-72.
  • Cheng,K. et al., 2003, Neurosignals. 12 (4-5):180-90.
  • Fischer,A. et al., 2003, Curr Drug Targets CNS Neurol Disord 2 (6): 375 - 81.
  • Lalioti,V. et al., 2010, Cell Cycle  9 (2): 284-311.
  • Cdk5 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Cdk5 cDNA ORF Clone in Cloning Vector, Mouse MG50574-M
    Cdk5 cDNA ORF Clone, Mouse, untagged MG50574-UT
    Cdk5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50574-ACG
    Cdk5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50574-ACGLN
    Cdk5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50574-ANG
    Cdk5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50574-ACR
    Cdk5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50574-ANR
    Cdk5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50574-CF
    Cdk5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50574-NF
    Cdk5 cDNA ORF Clone, Mouse, C-His tag MG50574-CH
    Cdk5 cDNA ORF Clone, Mouse, N-His tag MG50574-NH
    Cdk5 cDNA ORF Clone, Mouse, C-HA tag MG50574-CY
    Cdk5 cDNA ORF Clone, Mouse, N-HA tag MG50574-NY
    Cdk5 cDNA ORF Clone, Mouse, C-Myc tag MG50574-CM
    Cdk5 cDNA ORF Clone, Mouse, N-Myc tag MG50574-NM
    Cdk5 qPCR Primer Pairs, Mouse MP200566

    Cdk5 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Cdk5 cDNA ORF Clone in Cloning Vector, Human HG10897-M
    Cdk5 cDNA ORF Clone, Human, untagged HG10897-UT
    Cdk5 cDNA ORF Clone, Human, C-GFPSpark® tag HG10897-ACG
    Cdk5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10897-ACGLN
    Cdk5 cDNA ORF Clone, Human, N-GFPSpark® tag HG10897-ANG
    Cdk5 cDNA ORF Clone, Human, C-OFPSpark® tag HG10897-ACR
    Cdk5 cDNA ORF Clone, Human, N-OFPSpark® tag HG10897-ANR
    Cdk5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10897-CF
    Cdk5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10897-NF
    Cdk5 cDNA ORF Clone, Human, C-His tag HG10897-CH
    Cdk5 cDNA ORF Clone, Human, C-HA tag HG10897-CY
    Cdk5 cDNA ORF Clone, Human, N-HA tag HG10897-NY
    Cdk5 cDNA ORF Clone, Human, C-Myc tag HG10897-CM
    Cdk5 cDNA ORF Clone, Human, N-Myc tag HG10897-NM
    Cdk5 qPCR Primer Pairs, Human HP100781
    info info
    添加购物车成功! 添加购物车失败!