Text Size:AAA

Human CDK16/PCTK1/PCTAIRE1 Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human CDK16 cDNA Clone Product Information
    NCBI RefSeq:NM_001170460.1
    RefSeq ORF Size:1491bp
    cDNA Description:Full length Clone DNA of Human cyclin-dependent kinase 16 with C terminal His tag.
    Gene Synonym:PCTAIRE, FLJ16665, PCTAIRE1, PCTGAIRE
    Restriction Site:
    Sequence Description:
    Sequencing primers:T7( 5' TAATACGACTCACTATAGGG 3' )
    ( We provide with CDK16 qPCR primers for gene expression analysis, HP100607 )
    Promoter:Enhanced CMV cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.