K Cadherin cDNA ORF Clone, Human, N-Myc tag

Cat: HG10150-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All K Cadherin Reagents

CRO Services

Product recommended


All K Cadherin Reagents

K Cadherin cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1992 bp
Description
Full length Clone DNA of Human cadherin 6, type 2, K-cadherin (fetal kidney) with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

K Cadherin cDNA ORF Clone, Human, N-Myc tag Alternative Names

CAD6 cDNA ORF Clone, Human;KCAD cDNA ORF Clone, Human

K Cadherin Background Information

Cadherins are a family of calcium-dependent, cell-cell adhesion molecules that play an important morphoregulatory role in a wide variety of tissues. Alterations in cadherin function have been implicated in tumor progression in a number of adenocarcinomas. Cadherin-6 (CDH6), also known as K-cadherin (KCAD), is a type-II classic cadherin cell-cell adhesion molecules, which are expressed in graded or areal patterns, as well as layer-specific patterns, in the cortical plate. Human Cadherin-6 is synthesized as a 790 aa type I transmembrane glycoprotein that contains a 18 aa signal peptide, a 35 aa propeptide, a 562 aa extracellular region, a 21 aa transmembrane segment, and a 154 aa cytoplasmic domain. There are five cadherin domains of approximately 110 aa each in the extracellular region. Cadherin-6 is highly expressed in brain, cerebellum, and kidney, and may contribute to the formation of the segmental structure of the early brain, as well as the development of renal proximal tubules. Weak expression is also detected lung, pancreas, and gastric mucosa. Additionally, it is specifically expressed in the proximal tubule of normal kidneys and in renal cell cancer. Thus , Cadherin-6 is a new prognostic factor for renal cancer.

Full Name
cadherin 6, type 2, K-cadherin (fetal kidney)
References
  • Paul R, et al. (1997) Cadherin-6, a cell adhesion molecule specifically expressed in the proximal renal tubule and renal cell carcinoma. Cancer Res. 57(13): 2741-8.
  • Paul R, et al. (2004) Cadherin-6: a new prognostic marker for renal cell carcinoma. J Urol. 171(1): 97-101.
  • Taniguchi H, et al. (2006) Classic cadherins regulate tangential migration of precerebellar neurons in the caudal hindbrain. Development. 133(10): 1923-31.
  • Liu Q, et al. (2006) cadherin-6 message expression in the nervous system of developing zebrafish. Dev Dyn. 235(1): 272-8.
  • K Cadherin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    K Cadherin cDNA ORF Clone in Cloning Vector, Mouse MG50985-G
    K Cadherin cDNA ORF Clone, Mouse, untagged MG50985-UT
    K Cadherin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50985-ACG
    K Cadherin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50985-ACGLN
    K Cadherin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50985-ACR
    K Cadherin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50985-CF
    K Cadherin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50985-NF
    K Cadherin cDNA ORF Clone, Mouse, C-His tag MG50985-CH
    K Cadherin cDNA ORF Clone, Mouse, N-His tag MG50985-NH
    K Cadherin cDNA ORF Clone, Mouse, C-HA tag MG50985-CY
    K Cadherin cDNA ORF Clone, Mouse, N-HA tag MG50985-NY
    K Cadherin cDNA ORF Clone, Mouse, C-Myc tag MG50985-CM
    K Cadherin cDNA ORF Clone, Mouse, N-Myc tag MG50985-NM
    K Cadherin qPCR Primer Pairs, Mouse MP200951

    K Cadherin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    K Cadherin cDNA ORF Clone in Cloning Vector, Human HG10150-M
    K Cadherin cDNA ORF Clone, Human, untagged HG10150-UT
    K Cadherin cDNA ORF Clone, Human, C-GFPSpark® tag HG10150-ACG
    K Cadherin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10150-ACGLN
    K Cadherin cDNA ORF Clone, Human, C-OFPSpark® tag HG10150-ACR
    K Cadherin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10150-CF
    K Cadherin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10150-NF
    K Cadherin cDNA ORF Clone, Human, C-His tag HG10150-CH
    K Cadherin cDNA ORF Clone, Human, N-His tag HG10150-NH
    K Cadherin cDNA ORF Clone, Human, C-HA tag HG10150-CY
    K Cadherin cDNA ORF Clone, Human, N-HA tag HG10150-NY
    K Cadherin cDNA ORF Clone, Human, C-Myc tag HG10150-CM
    K Cadherin qPCR Primer Pairs, Human HP100221
    info info
    添加购物车成功! 添加购物车失败!