CDC42SE2 cDNA ORF Clone, Human, C-Myc tag

Cat: HG15598-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CDC42SE2 Reagents

CRO Services

Product recommended


All CDC42SE2 Reagents

CDC42SE2 cDNA ORF Clone, Human, C-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
255 bp
Description
Full length Clone DNA of Human CDC42 small effector 2 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CDC42SE2 cDNA ORF Clone, Human, C-Myc tag Alternative Names

SPEC2 cDNA ORF Clone, Human

CDC42SE2 Background Information

Full Name
CDC42 small effector 2

CDC42SE2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CDC42SE2 cDNA ORF Clone in Cloning Vector, Mouse MG52210-U
CDC42SE2 cDNA ORF Clone, Mouse, untagged MG52210-UT
CDC42SE2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52210-ACGLN
CDC42SE2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52210-ACG
CDC42SE2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52210-ANG
CDC42SE2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52210-ACR
CDC42SE2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52210-ANR
CDC42SE2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52210-CF
CDC42SE2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52210-NF
CDC42SE2 cDNA ORF Clone, Mouse, C-His tag MG52210-CH
CDC42SE2 cDNA ORF Clone, Mouse, N-His tag MG52210-NH
CDC42SE2 cDNA ORF Clone, Mouse, C-HA tag MG52210-CY
CDC42SE2 cDNA ORF Clone, Mouse, N-HA tag MG52210-NY
CDC42SE2 cDNA ORF Clone, Mouse, C-Myc tag MG52210-CM
CDC42SE2 cDNA ORF Clone, Mouse, N-Myc tag MG52210-NM
CDC42SE2 qPCR Primer Pairs, Mouse MP202083

CDC42SE2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CDC42SE2 cDNA ORF Clone in Cloning Vector, Human HG15598-G
CDC42SE2 cDNA ORF Clone, Human, untagged HG15598-UT
CDC42SE2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15598-ACG
CDC42SE2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15598-ACGLN
CDC42SE2 cDNA ORF Clone, Human, N-GFPSpark® tag HG15598-ANG
CDC42SE2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15598-ACR
CDC42SE2 cDNA ORF Clone, Human, N-OFPSpark® tag HG15598-ANR
CDC42SE2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15598-CF
CDC42SE2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15598-NF
CDC42SE2 cDNA ORF Clone, Human, C-His tag HG15598-CH
CDC42SE2 cDNA ORF Clone, Human, N-His tag HG15598-NH
CDC42SE2 cDNA ORF Clone, Human, C-HA tag HG15598-CY
CDC42SE2 cDNA ORF Clone, Human, N-HA tag HG15598-NY
CDC42SE2 cDNA ORF Clone, Human, N-Myc tag HG15598-NM
CDC42SE2 qPCR Primer Pairs, Human HP104218
info info
添加购物车成功! 添加购物车失败!