CDC42EP4 cDNA ORF Clone, Human, N-HA tag

Cat: HG14182-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CDC42EP4 Reagents
CRO Services
Product recommended

All CDC42EP4 Reagents
CDC42EP4 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1071 bp
Description
Full length Clone DNA of Human CDC42 effector protein (Rho GTPase binding) 4 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CDC42EP4 cDNA ORF Clone, Human, N-HA tag Alternative Names
BORG4 cDNA ORF Clone, Human;CEP4 cDNA ORF Clone, Human;KAIA1777 cDNA ORF Clone, Human
CDC42EP4 Background Information
Full Name
CDC42 effector protein (Rho GTPase binding) 4

CDC42EP4 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
CDC42EP4 cDNA ORF Clone in Cloning Vector, Rhesus CG90392-G
CDC42EP4 cDNA ORF Clone, Rhesus, untagged CG90392-UT
CDC42EP4 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90392-ACG
CDC42EP4 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90392-ACGLN
CDC42EP4 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90392-ANG
CDC42EP4 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90392-ACR
CDC42EP4 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90392-ANR
CDC42EP4 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90392-CF
CDC42EP4 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90392-NF
CDC42EP4 cDNA ORF Clone, Rhesus, C-His tag CG90392-CH
CDC42EP4 cDNA ORF Clone, Rhesus, N-His tag CG90392-NH
CDC42EP4 cDNA ORF Clone, Rhesus, C-HA tag CG90392-CY
CDC42EP4 cDNA ORF Clone, Rhesus, N-HA tag CG90392-NY
CDC42EP4 cDNA ORF Clone, Rhesus, C-Myc tag CG90392-CM
CDC42EP4 cDNA ORF Clone, Rhesus, N-Myc tag CG90392-NM

CDC42EP4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CDC42EP4 cDNA ORF Clone in Cloning Vector, Mouse MG5A2987-U
CDC42EP4 cDNA ORF Clone, Mouse, untagged MG5A2987-UT
CDC42EP4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2987-ACG
CDC42EP4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2987-ACGLN
CDC42EP4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A2987-ANG
CDC42EP4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A2987-ACR
CDC42EP4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A2987-ANR
CDC42EP4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A2987-CF
CDC42EP4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A2987-NF
CDC42EP4 cDNA ORF Clone, Mouse, C-His tag MG5A2987-CH
CDC42EP4 cDNA ORF Clone, Mouse, N-His tag MG5A2987-NH
CDC42EP4 cDNA ORF Clone, Mouse, C-HA tag MG5A2987-CY
CDC42EP4 cDNA ORF Clone, Mouse, N-HA tag MG5A2987-NY
CDC42EP4 cDNA ORF Clone, Mouse, C-Myc tag MG5A2987-CM
CDC42EP4 cDNA ORF Clone, Mouse, N-Myc tag MG5A2987-NM

CDC42EP4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CDC42EP4 cDNA ORF Clone in Cloning Vector, Human HG14182-G
CDC42EP4 cDNA ORF Clone, Human, untagged HG14182-UT
CDC42EP4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14182-ACGLN
CDC42EP4 cDNA ORF Clone, Human, C-GFPSpark® tag HG14182-ACG
CDC42EP4 cDNA ORF Clone, Human, N-GFPSpark® tag HG14182-ANG
CDC42EP4 cDNA ORF Clone, Human, C-OFPSpark® tag HG14182-ACR
CDC42EP4 cDNA ORF Clone, Human, N-OFPSpark® tag HG14182-ANR
CDC42EP4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14182-CF
CDC42EP4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14182-NF
CDC42EP4 cDNA ORF Clone, Human, C-His tag HG14182-CH
CDC42EP4 cDNA ORF Clone, Human, N-His tag HG14182-NH
CDC42EP4 cDNA ORF Clone, Human, C-HA tag HG14182-CY
CDC42EP4 cDNA ORF Clone, Human, C-Myc tag HG14182-CM
CDC42EP4 cDNA ORF Clone, Human, N-Myc tag HG14182-NM
CDC42EP4 qPCR Primer Pairs, Human HP102833
info info
添加购物车成功! 添加购物车失败!