Quick Order

Text Size:AAA

Human CDC37 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human CDC37 cDNA Clone Product Information
NCBI RefSeq:NM_007065.3
RefSeq ORF Size:1137bp
cDNA Description:Full length Clone DNA of Homo sapiens cell division cycle 37 homolog (S. cerevisiae) with C terminal HA tag.
Gene Synonym:P50CDC37
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

CDC37 is a protein that is expressed in proliferative zones during embryonic development and in adult tissues, consistent with a positive role in proliferation and is required for cell division in budding yeast. CDC37 is though to play an important role in the establishment of signaling pathways controlling cell proliferation through targeting intrinsically unstable oncoprotein kinases such as Cdk-4, Raf-1, and src to the molecular chaperone Hsp90. Decreased Hsp90 expression can reduce the levels of microtubule-associated protein tau, whose overexpression may induce many diseases. CDC37 is considered as a co-chaperone that is classified to Hsp90's accessory proteins. It has been reported that suppression of Cdc37 destabilized tau, leading to its clearance, whereas cdc37 overexpression preserved tau.Cdc37 was found to co-localize with tau in neuronal cells and to physically interact with tau from human brain. Moreover, Cdc37 levels significantly increased with age.

References
  • Dai K, et al. (1996) P hysical Interaction of Mammalian CDC37 with CDK4. The journal of biological chemistry. 271: 22030-4.
  • Pearl LH, et al. (2005) Hsp90 and Cdc37-a chaperone cancer conspiracy. Current opinion in genetics development. 15 (1): 55-61.
  • Chen GQ, et al. (2002) TNF-Induced Recruitment and Activation of the IKK Complex Require Cdc37 and Hsp90. Molecular cell. 9 (2): 401-10.
  • Size / Price
    Catalog: HG10647-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"