CDA cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG15215-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CDA Reagents
CRO Services
Product recommended

All CDA Reagents
CDA cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
441 bp
Description
Full length Clone DNA of Human cytidine deaminase with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CDA cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
CDD cDNA ORF Clone, Human
CDA Background Information
Full Name
cytidine deaminase

CDA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CDA cDNA ORF Clone in Cloning Vector, Mouse MG53891-U
CDA cDNA ORF Clone, Mouse, untagged MG53891-UT
CDA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53891-ACGLN
CDA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53891-ACG
CDA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53891-ACR
CDA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53891-CF
CDA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53891-NF
CDA cDNA ORF Clone, Mouse, C-His tag MG53891-CH
CDA cDNA ORF Clone, Mouse, N-His tag MG53891-NH
CDA cDNA ORF Clone, Mouse, C-HA tag MG53891-CY
CDA cDNA ORF Clone, Mouse, N-HA tag MG53891-NY
CDA cDNA ORF Clone, Mouse, C-Myc tag MG53891-CM
CDA cDNA ORF Clone, Mouse, N-Myc tag MG53891-NM

CDA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CDA cDNA ORF Clone in Cloning Vector, Human HG15215-G
CDA cDNA ORF Clone, Human, untagged HG15215-UT
CDA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15215-ACGLN
CDA cDNA ORF Clone, Human, C-GFPSpark® tag HG15215-ACG
CDA cDNA ORF Clone, Human, N-GFPSpark® tag HG15215-ANG
CDA cDNA ORF Clone, Human, C-OFPSpark® tag HG15215-ACR
CDA cDNA ORF Clone, Human, N-OFPSpark® tag HG15215-ANR
CDA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15215-CF
CDA cDNA ORF Clone, Human, C-His tag HG15215-CH
CDA cDNA ORF Clone, Human, N-His tag HG15215-NH
CDA cDNA ORF Clone, Human, C-HA tag HG15215-CY
CDA cDNA ORF Clone, Human, N-HA tag HG15215-NY
CDA cDNA ORF Clone, Human, C-Myc tag HG15215-CM
CDA cDNA ORF Clone, Human, N-Myc tag HG15215-NM
CDA qPCR Primer Pairs, Human HP103841
info info
添加购物车成功! 添加购物车失败!