CD97 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG11280-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD97 Reagents
CRO Services
Product recommended

All CD97 Reagents
CD97 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2229 bp
Description
Full length Clone DNA of Human adhesion G protein-coupled receptor E5 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
More Information About CD97
Entrez Gene ID

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD97 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
CD97 cDNA ORF Clone, Human;TM7LN1 cDNA ORF Clone, Human
CD97 Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. The CD97 is a receptor predominantly expressed in leukocytes and belongs to a new group of seven-span transmembrane molecules, which is also designed EGF-TM7 family. The family members are characterized by an extended extracellular region with several N-terminal epidermal growth factor-like domains two of which contain a calcium binding site. Muture CD 97 has two noncovalently associated subunits and is composed of a large extracellular protein (CD97 alpha) and a seven-membrane spanning protein (CD97 beta). CD97 is considered as a defining feature of G protein-coupled receptors. The effects that lymphocytes and erythrocytes adere to CD97-transfected COS cells suggest that CD97 has the ability to bind cellular ligands. CD97 alpha has three alternatively spliced isforms that are related to the calium binding EGF-like repeats in the microfibril protein fibrillin. Leukocytes strongly positive for CD97 are concentrated at sites of inflammation relative to CD97 expression in normal lymphoid tissues.

Full Name
adhesion G protein-coupled receptor E5
References
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Gray JX, et al. (1996) CD97 is a processed, seven-transmembrane, heterodimeric receptor associated with inflammation. The journal of Immunology. 157 (12): 5438-47.
  • Hamann J,et al. (1998) Characterization of the CD55 (DAF)-binding site on the seven-span transmembrane receptor CD97.European Journal of Immunology. 28 (5): 1701-7.
  • CD97 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD97 cDNA ORF Clone in Cloning Vector, Mouse MG50751-G
    CD97 cDNA ORF Clone, Mouse, untagged MG50751-UT
    CD97 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50751-ACGLN
    CD97 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50751-ACG
    CD97 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50751-ACR
    CD97 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50751-CF
    CD97 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50751-NF
    CD97 cDNA ORF Clone, Mouse, C-His tag MG50751-CH
    CD97 cDNA ORF Clone, Mouse, N-His tag MG50751-NH
    CD97 cDNA ORF Clone, Mouse, C-HA tag MG50751-CY
    CD97 cDNA ORF Clone, Mouse, N-HA tag MG50751-NY
    CD97 cDNA ORF Clone, Mouse, C-Myc tag MG50751-CM
    CD97 cDNA ORF Clone, Mouse, N-Myc tag MG50751-NM
    CD97 qPCR Primer Pairs, Mouse MP200726

    CD97 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD97 cDNA ORF Clone in Cloning Vector, Human HG29661-M
    CD97 cDNA ORF Clone in Cloning Vector, Human HG11280-U
    CD97 cDNA ORF Clone, Human, untagged HG11280-UT
    CD97 cDNA ORF Clone, Human, C-GFPSpark® tag HG29661-ACG
    CD97 cDNA ORF Clone, Human, C-GFPSpark® tag HG11280-ACG
    CD97 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11280-ACGLN
    CD97 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG29661-ACGLN
    CD97 cDNA ORF Clone, Human, C-OFPSpark® tag HG11280-ACR
    CD97 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11280-CF
    CD97 cDNA ORF Clone, Human, C-His tag HG11280-CH
    CD97 cDNA ORF Clone, Human, N-His tag HG11280-NH
    CD97 cDNA ORF Clone, Human, C-HA tag HG11280-CY
    CD97 cDNA ORF Clone, Human, N-HA tag HG11280-NY
    CD97 cDNA ORF Clone, Human, C-Myc tag HG11280-CM
    CD97 cDNA ORF Clone, Human, N-Myc tag HG11280-NM
    CD97 qPCR Primer Pairs, Human HP100102
    info info
    添加购物车成功! 添加购物车失败!