CD89 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10414-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD89 Reagents
CRO Services
Product recommended

All CD89 Reagents
CD89 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
864 bp
Description
Full length Clone DNA of Human Fc fragment of IgA, receptor for (FCAR), transcript variant 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD89 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human CD89/FCAR Gene Expression validated Image 16092
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
CD89 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CD89 cDNA ORF Clone, Human;CTB-61M7.2 cDNA ORF Clone, Human;FcalphaRI cDNA ORF Clone, Human;FCAR cDNA ORF Clone, Human;XXbac-BPG230H20.5 cDNA ORF Clone, Human
CD89 Background Information

FCAR, also called FcαRI or CD89, is a type I  transmembrane receptor for Fc region of IgA which is the most abundant immunoglobulin in mucosal areas but is only the second most common antibody isotype in serum. This receptor is present on the surface of myeloid lineage cells such as neutrophils, monocytes, macrophages, and eosinophils, especially phagocytes located in mucosal areas. Upon ligand IgA binding, FcαRI associates with the FcR γ signaling molecule bearing the immunoreceptor tyrosine-based activation motif (ITAM) through a unique charge-based mechanism and triggers multiple cell-mediated immune responses. It has been reported that Fc RI is a dual-function receptor that can mediate both inflammatory and anti-inflammatory responses depending on the type of interaction with its ligand. Sustained aggregation of FCAR results in activation of target-cell functions such as antigen presentation and cytokine release. In contrast, Monomeric targeting with serum IgA or with a variety of anti-FcαRI Fab fragments triggers an inhibitory response and additionally induces apoptosis. FcαRI thus play an fundamental role in preventing tumor development and growth, as well as in controlling inflammation.

Full Name
Fc fragment of IgA receptor
References
  • Maliszewski, C.R. et al., 1990, J. Exp. Med. 172: 1665-1672.
  • CD89 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD89 cDNA ORF Clone in Cloning Vector, Rat RG80014-M
    CD89 cDNA ORF Clone, Rat, untagged RG80014-UT
    CD89 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80014-ACGLN
    CD89 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80014-ACG
    CD89 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80014-ACR
    CD89 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80014-CF
    CD89 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80014-NF
    CD89 cDNA ORF Clone, Rat, C-His tag RG80014-CH
    CD89 cDNA ORF Clone, Rat, N-His tag RG80014-NH
    CD89 cDNA ORF Clone, Rat, C-HA tag RG80014-CY
    CD89 cDNA ORF Clone, Rat, N-HA tag RG80014-NY
    CD89 cDNA ORF Clone, Rat, C-Myc tag RG80014-CM
    CD89 cDNA ORF Clone, Rat, N-Myc tag RG80014-NM
    CD89 qPCR Primer Pairs, Rat RP300013

    CD89 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD89 cDNA ORF Clone in Cloning Vector, Human HG10414-M
    CD89 cDNA ORF Clone, Human, untagged HG10414-UT
    CD89 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10414-ACGLN
    CD89 cDNA ORF Clone, Human, C-GFPSpark® tag HG10414-ACG
    CD89 cDNA ORF Clone, Human, C-OFPSpark® tag HG10414-ACR
    CD89 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10414-NF
    CD89 cDNA ORF Clone, Human, C-His tag HG10414-CH
    CD89 cDNA ORF Clone, Human, N-His tag HG10414-NH
    CD89 cDNA ORF Clone, Human, C-HA tag HG10414-CY
    CD89 cDNA ORF Clone, Human, N-HA tag HG10414-NY
    CD89 cDNA ORF Clone, Human, C-Myc tag HG10414-CM
    CD89 cDNA ORF Clone, Human, N-Myc tag HG10414-NM
    CD89 qPCR Primer Pairs, Human HP100444
    info info
    添加购物车成功! 添加购物车失败!