Text Size:AAA

Human CD89/FCAR transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Human FCAR cDNA Clone Product Information
    NCBI RefSeq:NM_002000.2
    RefSeq ORF Size:864bp
    cDNA Description:Full length Clone DNA of Homo sapiens Fc fragment of IgA, receptor for (FCAR), transcript variant 1 with N terminal Flag tag.
    Gene Synonym:CD89, FCAR
    Species:Human
    Vector:pCMV3-SP-N-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FCAR qPCR primers for gene expression analysis, HP100444 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    FCAR, also called FcαRI or CD89, is a type I  transmembrane receptor for Fc region of IgA which is the most abundant immunoglobulin in mucosal areas but is only the second most common antibody isotype in serum. This receptor is present on the surface of myeloid lineage cells such as neutrophils, monocytes, macrophages, and eosinophils, especially phagocytes located in mucosal areas. Upon ligand IgA binding, FcαRI associates with the FcR γ signaling molecule bearing the immunoreceptor tyrosine-based activation motif (ITAM) through a unique charge-based mechanism and triggers multiple cell-mediated immune responses. It has been reported that Fc RI is a dual-function receptor that can mediate both inflammatory and anti-inflammatory responses depending on the type of interaction with its ligand. Sustained aggregation of FCAR results in activation of target-cell functions such as antigen presentation and cytokine release. In contrast, Monomeric targeting with serum IgA or with a variety of anti-FcαRI Fab fragments triggers an inhibitory response and additionally induces apoptosis. FcαRI thus play an fundamental role in preventing tumor development and growth, as well as in controlling inflammation.

    References
    1. Maliszewski, C.R. et al., 1990, J. Exp. Med. 172: 1665-1672.
    2. Launay, P. et al., 1999, J. Biol. Chem. 274: 7216-7225.
    3. Monteiro, R.C. et al., 2003, Annu. Rev. Immunol. 21: 177-204.
    4. Otten, M.A. et al., 2005, J. Immunol. 174: 5472-5480.
    5. Pasquier, B. et al., 2005, Immunity. 22:31-42.
    6. Kanamaru, Y. et al., 2007, Blood. 109: 203-211.
    Size / Price
    Catalog: HG10414-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"