CD74 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11091-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CD74 Reagents
CRO Services
Product recommended

All CD74 Reagents
CD74 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
699 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CD74 molecule, major histocompatibility complex, class II invariant chain, transcript variant 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 0.75kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CD74 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD74 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human CD74 Gene Expression validated Image 1704
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
other Green fluorescent protein / GFP Gene Plasmid Map 5609
CD74 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
DHLAG cDNA ORF Clone, Human;HLADG cDNA ORF Clone, Human;Ia-GAMMA cDNA ORF Clone, Human;II cDNA ORF Clone, Human
CD74 Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD74, also known as HLA class2 histocompatibility antigen gamma chain and HLA-DR antigens-associated invariant chain, is a polypeptide involved in the formation and transport of MHC class2 protein. CD74 is expressed by B cells, macrophages, and Reed-Sternberg cells. When MHC class 2 protein was in the rough ER, its peptide-binding cleft was blocked by CD74 to prevent it from interacting with the endogenous peptides. CD74 also serves to facilitate MHC class2's export from ER.

Full Name
CD74 molecule, major histocompatibility complex, class II invariant chain
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Moynes R, et al. (1997) A marker to distinguish atypical fibroxanthoma from malignant fibrous histiocytoma. Cancer. 79 (11): 2115-24.
  • Gabrielle FA, et al. (2008) Regulation of dendritic cell migration by CD74, the MHC class 2-associated invariant chain. Science. 322 (5908): 1705-10.
  • Leng L, et al. (2003) MIF signal transduction initiated by binding to CD74. JEM.197 (11): 1467-76.
  • CD74 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    CD74 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90682-G
    CD74 cDNA ORF Clone, Cynomolgus, untagged CG90682-UT
    CD74 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90682-ACGLN
    CD74 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90682-ACG
    CD74 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90682-ACR
    CD74 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90682-CF
    CD74 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90682-NF
    CD74 cDNA ORF Clone, Cynomolgus, C-His tag CG90682-CH
    CD74 cDNA ORF Clone, Cynomolgus, N-His tag CG90682-NH
    CD74 cDNA ORF Clone, Cynomolgus, C-HA tag CG90682-CY
    CD74 cDNA ORF Clone, Cynomolgus, N-HA tag CG90682-NY
    CD74 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90682-CM
    CD74 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90682-NM

    CD74 cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    CD74 cDNA ORF Clone in Cloning Vector, Ferret FG60049-G
    CD74 cDNA ORF Clone, Ferret, untagged FG60049-UT
    CD74 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60049-ACGLN
    CD74 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60049-ACG
    CD74 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60049-ACR
    CD74 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60049-CF
    CD74 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60049-NF
    CD74 cDNA ORF Clone, Ferret, C-His tag FG60049-CH
    CD74 cDNA ORF Clone, Ferret, N-His tag FG60049-NH
    CD74 cDNA ORF Clone, Ferret, C-HA tag FG60049-CY
    CD74 cDNA ORF Clone, Ferret, N-HA tag FG60049-NY
    CD74 cDNA ORF Clone, Ferret, C-Myc tag FG60049-CM
    CD74 cDNA ORF Clone, Ferret, N-Myc tag FG60049-NM

    CD74 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD74 cDNA ORF Clone in Cloning Vector, Rat RG8A6910-U
    CD74 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A6910-ACGLN

    CD74 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD74 cDNA ORF Clone in Cloning Vector, Mouse MG50738-G
    CD74 cDNA ORF Clone, Mouse, untagged MG50738-UT
    CD74 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50738-ACGLN
    CD74 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50738-ACG
    CD74 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50738-ACR
    CD74 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50738-CF
    CD74 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50738-NF
    CD74 cDNA ORF Clone, Mouse, C-His tag MG50738-CH
    CD74 cDNA ORF Clone, Mouse, N-His tag MG50738-NH
    CD74 cDNA ORF Clone, Mouse, C-HA tag MG50738-CY
    CD74 cDNA ORF Clone, Mouse, N-HA tag MG50738-NY
    CD74 cDNA ORF Clone, Mouse, C-Myc tag MG50738-CM
    CD74 cDNA ORF Clone, Mouse, N-Myc tag MG50738-NM
    CD74 qPCR Primer Pairs, Mouse MP200713

    CD74 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD74 cDNA ORF Clone in Cloning Vector, Human HG11091-M
    CD74 cDNA ORF Clone, Human, untagged HG11091-UT
    CD74 cDNA ORF Clone, Human, C-GFPSpark® tag HG11091-ACG
    CD74 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11091-ACGLN
    CD74 cDNA ORF Clone, Human, C-OFPSpark® tag HG11091-ACR
    CD74 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11091-NF
    CD74 cDNA ORF Clone, Human, C-His tag HG11091-CH
    CD74 cDNA ORF Clone, Human, N-His tag HG11091-NH
    CD74 cDNA ORF Clone, Human, C-HA tag HG11091-CY
    CD74 cDNA ORF Clone, Human, N-HA tag HG11091-NY
    CD74 cDNA ORF Clone, Human, C-Myc tag HG11091-CM
    CD74 cDNA ORF Clone, Human, N-Myc tag HG11091-NM
    CD74 qPCR Primer Pairs, Human HP101008
    info info
    添加购物车成功! 添加购物车失败!