CEACAM5 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11077-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CEACAM5 Reagents
CRO Services
Product recommended

All CEACAM5 Reagents
CEACAM5 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2148 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human carcinoembryonic antigen-related cell adhesion molecule 5 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 2.14kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CEACAM5 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CEACAM5 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human CEACAM5/CEA/CD66e Gene Expression validated Image 1699
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
other Green fluorescent protein / GFP Gene Plasmid Map 5609
CEACAM5 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CD66e cDNA ORF Clone, Human;CEA cDNA ORF Clone, Human
CEACAM5 Background Information

CEACAM5, also known as CEA or D66e, belongs to the large CEACAM subfamily of immunoglobulin superfamily. CEACAM5 is expressed primarily by epithelial cells, and is synthesized as a glycoprotein with a MW of 180 kDa comprising 60% carbohydrate. CEACAM5 contains one Ig-like V-type domain at the N-terminus, followed by six Ig-like C2-type domain and a GPI anchor, and exists as a homodimer. CEACAM5 and CEACAM6 are overexpressed in many cancers and are associated with adhesion and invasion. CEACAM5 can mediate cell-cell adhesion through homotypic and heterotypic interactions. It functions as a homotypic intercellular adhesion molecule and serves as a widely used tumor marker, since it is expressed at higher levels in tumorous tissues than in corresponding normal tissues. CEACAM5 has also been shown to contribute to tumorigenicity by inhibiting cellular differentiation. In addition, CEACAM5 is identified as the host receptor for the Dr family of adhesins of E.Coli, and the binding of E.coli Dr adhesins leads to dissociation of the CEACAM5 homodimer.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
carcinoembryonic antigen-related cell adhesion molecule 5
References
  • Baczyska D, et al. (2003) The tumorigenic potential of human CX-1 colon adenocarcinoma cells depends on carcinoembryonic antigen (CEACAM5) expression. Cell Mol Biol Lett. 8(2): 471-86.
  • Blumenthal RD, et al. (2005) Inhibition of adhesion, invasion, and metastasis by antibodies targeting CEACAM6 (NCA-90) and CEACAM5 (Carcinoembryonic Antigen). Cancer Res. 65(19): 8809-17.
  • Liebig B, et al. (2005) Forced expression of deltaN-TCF-1B in colon cancer derived cell lines is accompanied by the induction of CEACAM5/6 and mesothelin. Cancer Lett. 223(1): 159-67.
  • info info
    添加购物车成功! 添加购物车失败!