Text Size:AAA

Human CEACAM5/CEA/CD66e Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human CEACAM5 cDNA Clone Product Information
    NCBI RefSeq:NM_004363.2
    RefSeq ORF Size:2094bp
    cDNA Description:Full length Clone DNA of Homo sapiens carcinoembryonic antigen-related cell adhesion molecule 5.
    Gene Synonym:CEA, CD66e, DKFZp781M2392, CEACAM5
    Species:Human
    Vector:pCMV3-untagged
    Plasmid:pCMV3-CEACAM5
    Restriction Site:KpnI + XbaI (6.1kb + 2.09kb)
    Tag Sequence:
    Sequence Description:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CEACAM5 qPCR primers for gene expression analysis, HP101000 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Background

    CEACAM5, also known as CEA or D66e, belongs to the large CEACAM subfamily of immunoglobulin superfamily. CEACAM5 is expressed primarily by epithelial cells, and is synthesized as a glycoprotein with a MW of 180 kDa comprising 60% carbohydrate. CEACAM5 contains one Ig-like V-type domain at the N-terminus, followed by six Ig-like C2-type domain and a GPI anchor, and exists as a homodimer. CEACAM5 and CEACAM6 are overexpressed in many cancers and are associated with adhesion and invasion. CEACAM5 can mediate cell-cell adhesion through homotypic and heterotypic interactions. It functions as a homotypic intercellular adhesion molecule and serves as a widely used tumor marker, since it is expressed at higher levels in tumorous tissues than in corresponding normal tissues. CEACAM5 has also been shown to contribute to tumorigenicity by inhibiting cellular differentiation. In addition, CEACAM5 is identified as the host receptor for the Dr family of adhesins of E.Coli, and the binding of E.coli Dr adhesins leads to dissociation of the CEACAM5 homodimer.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Baczyska D, et al. (2003) The tumorigenic potential of human CX-1 colon adenocarcinoma cells depends on carcinoembryonic antigen (CEACAM5) expression. Cell Mol Biol Lett. 8(2): 471-86.
  • Blumenthal RD, et al. (2005) Inhibition of adhesion, invasion, and metastasis by antibodies targeting CEACAM6 (NCA-90) and CEACAM5 (Carcinoembryonic Antigen). Cancer Res. 65(19): 8809-17.
  • Liebig B, et al. (2005) Forced expression of deltaN-TCF-1B in colon cancer derived cell lines is accompanied by the induction of CEACAM5/6 and mesothelin. Cancer Lett. 223(1): 159-67.
  • Size / Price
    Catalog: HG11077-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"