CEACAM6 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10823-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CEACAM6 Reagents
CRO Services
Product recommended

All CEACAM6 Reagents
CEACAM6 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1035 bp
Description
Full length Clone DNA of Human carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CEACAM6 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CD66c cDNA ORF Clone, Human;CEA cDNA ORF Clone, Human;CEAL cDNA ORF Clone, Human;NCA cDNA ORF Clone, Human
CEACAM6 Background Information

Carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6), also known as nonspecific crossreacting antigen (NCA) and CD66c, is one of seven human CEACAM family members within the immunoglobulin superfamily. It s a glycosylphosphatidylinositol-linked immunoglobulin superfamily member that is overexpressed in a variety of human cancers, including colon, breast and lung and is associated with tumourigenesis, tumour cell adhesion, invasion and metastasis. CEACAM6 is a unique mediator of migration and invasion of drug resistant oestrogen-deprived breast cancer cells, and this protein could be an important biomarker of metastasis. CEACAM6 is expressed by granulocytes and their progenitors. It is also expressed by epithelia of various organs and is upregulated in pancreatic and colon adenocarcinomas, as well as hyperplastic polyps. Resistance to adhesion-related apoptosis in tumor cells is conferred in the condition of CEACAM6 overexpression.

Full Name
carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen)
References
  • Duxbury MS, et al. (2004) Overexpression of CEACAM6 promotes insulin-like growth factor I-induced pancreatic adenocarcinoma cellular invasiveness. Oncogene. 23(34): 5834-42.
  • Lewis-Wambi JS, et al. (2008) Overexpression of CEACAM6 promotes migration and invasion of oestrogen-deprived breast cancer cells. Eur J Cancer. 44(12): 1770-9.
  • info info
    添加购物车成功! 添加购物车失败!