Quick Order

Text Size:AAA

Human CEACAM6/CD66c Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human CEACAM6 cDNA Clone Product Information
NCBI RefSeq:NM_002483.4
RefSeq ORF Size:1035bp
cDNA Description:Full length Clone DNA of Homo sapiens carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen) with N terminal Myc tag.
Gene Synonym:NCA, CEAL, CD66c, CEACAM6
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6), also known as nonspecific crossreacting antigen (NCA) and CD66c, is one of seven human CEACAM family members within the immunoglobulin superfamily. It s a glycosylphosphatidylinositol-linked immunoglobulin superfamily member that is overexpressed in a variety of human cancers, including colon, breast and lung and is associated with tumourigenesis, tumour cell adhesion, invasion and metastasis. CEACAM6 is a unique mediator of migration and invasion of drug resistant oestrogen-deprived breast cancer cells, and this protein could be an important biomarker of metastasis. CEACAM6 is expressed by granulocytes and their progenitors. It is also expressed by epithelia of various organs and is upregulated in pancreatic and colon adenocarcinomas, as well as hyperplastic polyps. Resistance to adhesion-related apoptosis in tumor cells is conferred in the condition of CEACAM6 overexpression.

References
  • Duxbury MS, et al. (2004) Overexpression of CEACAM6 promotes insulin-like growth factor I-induced pancreatic adenocarcinoma cellular invasiveness. Oncogene. 23(34): 5834-42.
  • Lewis-Wambi JS, et al. (2008) Overexpression of CEACAM6 promotes migration and invasion of oestrogen-deprived breast cancer cells. Eur J Cancer. 44(12): 1770-9.
  • Size / Price
    Catalog: HG10823-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"