CD63 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG11271-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD63 Reagents
CRO Services
Product recommended

All CD63 Reagents
CD63 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
717 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CD63 molecule with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Restriction Sites
KpnI + XbaI (6kb + 0.76kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CD63 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD63 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human aFGF/FGF1 Gene Plasmid Map 5637
Human CD63 Gene Expression validated Image 16496
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
CD63 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
LAMP-3 cDNA ORF Clone, Human;ME491 cDNA ORF Clone, Human;MLA1 cDNA ORF Clone, Human;OMA81H cDNA ORF Clone, Human;TSPAN30 cDNA ORF Clone, Human
CD63 Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 63 (CD63) is a member of the CD family and the transmembrane 4 superfamily,also known as the tetraspanin family. CD63 is a cellular surface glycoprotein characterized by the presence of four bydrophobic domains. CD63 had functions in mediating signal transduction processes and then regulate variety of cellular processes such as cell proliferation, activation and motility. It has reported that CD63 protein associated with tumor progression and served as a blood platlet activation marker and the deficiency of this protein may be associated with Hermansky-Pudlak syndrome.

Full Name
CD63 molecule
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Radford KJ, et al. (1996) Associates with Transmembrane 4 Superfamily Members, CD9 and CD81, and with beta 1 Integrins in Human Melanoma. Biochemical Biophysical Research Communications. 222(1): 13-18.
  • Metzelaar MJ, et al. (1991) CD63 antigen, A novel lysosomal membrane glycoprotein, cloned by a screening procedure for intracellular antigens in eukaryotic cells. The journal of biological chemistry. 266: 3239-45.
  • CD63 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD63 cDNA ORF Clone in Cloning Vector, Rhesus CG90191-G
    CD63 cDNA ORF Clone, Rhesus, untagged CG90191-UT
    CD63 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90191-ACG
    CD63 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90191-ACGLN
    CD63 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90191-ACR
    CD63 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90191-CF
    CD63 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90191-NF
    CD63 cDNA ORF Clone, Rhesus, C-His tag CG90191-CH
    CD63 cDNA ORF Clone, Rhesus, N-His tag CG90191-NH
    CD63 cDNA ORF Clone, Rhesus, C-HA tag CG90191-CY
    CD63 cDNA ORF Clone, Rhesus, N-HA tag CG90191-NY
    CD63 cDNA ORF Clone, Rhesus, C-Myc tag CG90191-CM
    CD63 cDNA ORF Clone, Rhesus, N-Myc tag CG90191-NM

    CD63 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD63 cDNA ORF Clone in Cloning Vector, Rat RG80304-G
    CD63 cDNA ORF Clone, Rat, untagged RG80304-UT
    CD63 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80304-ACG
    CD63 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80304-ACGLN
    CD63 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80304-ACR
    CD63 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80304-CF
    CD63 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80304-NF
    CD63 cDNA ORF Clone, Rat, C-His tag RG80304-CH
    CD63 cDNA ORF Clone, Rat, N-His tag RG80304-NH
    CD63 cDNA ORF Clone, Rat, C-HA tag RG80304-CY
    CD63 cDNA ORF Clone, Rat, N-HA tag RG80304-NY
    CD63 cDNA ORF Clone, Rat, C-Myc tag RG80304-CM
    CD63 cDNA ORF Clone, Rat, N-Myc tag RG80304-NM
    CD63 qPCR Primer Pairs, Rat RP300280

    CD63 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD63 cDNA ORF Clone in Cloning Vector, Mouse MG50557-M
    CD63 cDNA ORF Clone, Mouse, untagged MG50557-UT
    CD63 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50557-ACG
    CD63 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50557-ACGLN
    CD63 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50557-ANG
    CD63 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50557-ACR
    CD63 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50557-CF
    CD63 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50557-NF
    CD63 cDNA ORF Clone, Mouse, C-His tag MG50557-CH
    CD63 cDNA ORF Clone, Mouse, N-His tag MG50557-NH
    CD63 cDNA ORF Clone, Mouse, C-HA tag MG50557-CY
    CD63 cDNA ORF Clone, Mouse, N-HA tag MG50557-NY
    CD63 cDNA ORF Clone, Mouse, C-Myc tag MG50557-CM
    CD63 cDNA ORF Clone, Mouse, N-Myc tag MG50557-NM
    CD63 qPCR Primer Pairs, Mouse MP200549

    CD63 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD63 cDNA ORF Clone in Cloning Vector, Human HG11271-M
    CD63 cDNA ORF Clone, Human, untagged HG11271-UT
    CD63 cDNA ORF Clone, Human, C-GFPSpark® tag HG11271-ACG
    CD63 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11271-ACGLN
    CD63 cDNA ORF Clone, Human, N-GFPSpark® tag HG11271-ANG
    CD63 cDNA ORF Clone, Human, C-OFPSpark® tag HG11271-ACR
    CD63 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11271-CF
    CD63 cDNA ORF Clone, Human, C-His tag HG11271-CH
    CD63 cDNA ORF Clone, Human, N-His tag HG11271-NH
    CD63 cDNA ORF Clone, Human, C-HA tag HG11271-CY
    CD63 cDNA ORF Clone, Human, N-HA tag HG11271-NY
    CD63 cDNA ORF Clone, Human, C-Myc tag HG11271-CM
    CD63 cDNA ORF Clone, Human, N-Myc tag HG11271-NM
    CD63 qPCR Primer Pairs, Human HP100068
    info info
    添加购物车成功! 添加购物车失败!