CD5L cDNA ORF Clone, Human, N-His tag

Cat: HG10791-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD5L Reagents
CRO Services
Product recommended

All CD5L Reagents
CD5L cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1044 bp
Description
Full length Clone DNA of Human CD5 molecule-like with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD5L cDNA ORF Clone, Human, N-His tag Alternative Names
AIM cDNA ORF Clone, Human;API6 cDNA ORF Clone, Human;PRO229 cDNA ORF Clone, Human;SP-ALPHA cDNA ORF Clone, Human;Spalpha cDNA ORF Clone, Human
CD5L Background Information

CD5L, also known as CD5 antigen-like, is a soluble protein belonging to group B of the scavenger receptor cysteine-rich (SRCR) superfamily and contains three SRCR domains. It is a secreted glycoprotein and expressed by macrophages presentin lymphoid tissues (spleen, lymph node, thymus, and bone marrow). It binds to myelomonocytic and lymphoid cells and may play an important role in the regulation of the innate and adaptive immune systems. CD5L functions as a pattern recognition molecule by binding both lipoteichoic acid (LTA) on Gram positive and lipopolysaccharide (LPS) on Gram negative bacteria. and the SRCR domain 1 of CD5L retains both the LPS and LTA binding activities. In addtion, it is revealed that CD5L seems to play a role as an inhibitor of apoptosis.

Full Name
CD5 molecule-like
References
  • Resnick, D. et al., 1994, Trends Biochem. Sci. 19: 5-8.
  • Gebe, J. A. et al., 1997, J. Biol. Chem. 272 (10): 6151–6158.
  • Sarrias, M.R. et al., 2004, Crit. Rev. Immunol. 24: 1-37.
  • Mukhopadhyay, S. and Gordon, S., 2004, Immunobiology 209: 39-49.
  • Sarrias, M. R. et al.,2005, J. Biol. Chem. 280 (42): 35391–35398.
  • CD5L cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD5L cDNA ORF Clone in Cloning Vector, Mouse MG50020-M
    CD5L cDNA ORF Clone, Mouse, untagged MG50020-UT
    CD5L Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50020-ACGLN
    CD5L cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50020-ACG
    CD5L cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50020-ACR
    CD5L cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50020-CF
    CD5L cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50020-NF
    CD5L cDNA ORF Clone, Mouse, C-His tag MG50020-CH
    CD5L cDNA ORF Clone, Mouse, N-His tag MG50020-NH
    CD5L cDNA ORF Clone, Mouse, C-HA tag MG50020-CY
    CD5L cDNA ORF Clone, Mouse, N-HA tag MG50020-NY
    CD5L cDNA ORF Clone, Mouse, C-Myc tag MG50020-CM
    CD5L cDNA ORF Clone, Mouse, N-Myc tag MG50020-NM
    CD5L qPCR Primer Pairs, Mouse MP200020

    CD5L cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD5L cDNA ORF Clone in Cloning Vector, Human HG10791-M
    CD5L cDNA ORF Clone, Human, untagged HG10791-UT
    CD5L Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10791-ACGLN
    CD5L cDNA ORF Clone, Human, C-GFPSpark® tag HG10791-ACG
    CD5L cDNA ORF Clone, Human, C-OFPSpark® tag HG10791-ACR
    CD5L cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10791-CF
    CD5L cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10791-NF
    CD5L cDNA ORF Clone, Human, C-His tag HG10791-CH
    CD5L cDNA ORF Clone, Human, C-HA tag HG10791-CY
    CD5L cDNA ORF Clone, Human, N-HA tag HG10791-NY
    CD5L cDNA ORF Clone, Human, C-Myc tag HG10791-CM
    CD5L cDNA ORF Clone, Human, N-Myc tag HG10791-NM
    CD5L qPCR Primer Pairs, Human HP100705
    info info
    添加购物车成功! 添加购物车失败!