Quick Order

Human CD5L Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Human CD5L cDNA Clone Product Information
    NCBI RefSeq:NM_005894.2
    RefSeq ORF Size:1044bp
    cDNA Description:Full length Clone DNA of Homo sapiens CD5 molecule-like with N terminal Myc tag.
    Gene Synonym:AIM, API6, PRO229, Spalpha, SP-ALPHA
    Species:Human
    Vector:pCMV3-SP-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CD5L qPCR primers for gene expression analysis, HP100705 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    CD5L, also known as CD5 antigen-like, is a soluble protein belonging to group B of the scavenger receptor cysteine-rich (SRCR) superfamily and contains three SRCR domains. It is a secreted glycoprotein and expressed by macrophages presentin lymphoid tissues (spleen, lymph node, thymus, and bone marrow). It binds to myelomonocytic and lymphoid cells and may play an important role in the regulation of the innate and adaptive immune systems. CD5L functions as a pattern recognition molecule by binding both lipoteichoic acid (LTA) on Gram positive and lipopolysaccharide (LPS) on Gram negative bacteria. and the SRCR domain 1 of CD5L retains both the LPS and LTA binding activities. In addtion, it is revealed that CD5L seems to play a role as an inhibitor of apoptosis.

    References
  • Resnick, D. et al., 1994, Trends Biochem. Sci. 19: 5-8.
  • Gebe, J. A. et al., 1997, J. Biol. Chem. 272 (10): 6151–6158.
  • Sarrias, M.R. et al., 2004, Crit. Rev. Immunol. 24: 1-37.
  • Mukhopadhyay, S. and Gordon, S., 2004, Immunobiology 209: 39-49.
  • Sarrias, M. R. et al.,2005, J. Biol. Chem. 280 (42): 35391–35398.
  • Size / Price
    Catalog: HG10791-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"