Quick Order

Human CD53 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human CD53 cDNA Clone Product Information
NCBI RefSeq:NM_000560.3
RefSeq ORF Size:660bp
cDNA Description:Full length Clone DNA of Homo sapiens CD53 molecule with C terminal Myc tag.
Gene Synonym:MOX44, TSPAN25, CD53
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

CD53 is a member of the transmembrane 4 superfamily, also called the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. These proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. CD53 is a cell surface glycoprotein that is known to complex with integrins. Familial deficiency of CD53 gene has been linked to an immunodeficiency associated with recurrent infectious diseases caused by bacteria, fungi and viruses. CD53 contributes to the transduction of CD2-generated signals in T cells and natural killer cells and has been suggested to play a role in growth regulation.

References
  • Rochelle JM, et al. (1993) Gene structure, chromosomal localization, and protein sequence of mouse CD53 (Cd53): evidence that the transmembrane 4 superfamily arose by gene duplication. Int Immunol. 5(2):209-16.
  • Virtaneva KI, et al. (1993) The genes for CD37, CD53, and R2, all members of a novel gene family, are located on different chromosomes. Immunogenetics. 37(6):461-5.
  • Horejsí V, et al. (1991) Novel structurally distinct family of leucocyte surface glycoproteins including CD9, CD37, CD53 and CD63. FEBS Lett. 288(1-2):1-4.
  • Size / Price
    Catalog: HG11409-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"