Quick Order

Human CD46 Gene ORF cDNA clone expression plasmid, N-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Human CD46 cDNA Clone Product Information
    NCBI RefSeq:BC030594
    RefSeq ORF Size:1155bp
    cDNA Description:Full length Clone DNA of Homo sapiens CD46 molecule, complement regulatory protein with N terminal HA tag.
    Gene Synonym:MCP, TLX, AHUS2, MIC10, TRA2.10, CD46
    Species:Human
    Vector:pCMV3-N-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CD46 qPCR primers for gene expression analysis, HP100030 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    CD46, also known as Membrane Cofactor Protein (MCP), is a complement regulatory protein. CD46 is a type 1 membrane protein that plays an important inhibitory role in the complement system. CD46 is expressed in white blood cells, platelets, epithelial cells, and fibroblasts. Human CD46 shares 50% amino acid sequence identity with mouse and rat CD46. The importance of CD46 to complement regulation is underscored by the observation that genetic loss of CD46 leads to development of atypical hemolytic-uremic syndrome (aHUS), a disease characterized by uncontrolled complement activation. CD46 is implicated in the development and/or progression of selected cancer types.

    References
  • Lublin D.M., et al.,(1988), Molecular cloning and chromosomal localization of human membrane cofactor protein (MCP). Evidence for inclusion in the multigene family of complement-regulatory proteins. J. Exp. Med. 168:181-194.
  • Purcell D.F., et al., (1991), Alternatively spliced RNAs encode several isoforms of CD46 (MCP), a regulator of complement activation.Immunogenetics 33:335-344.
  • Post T.W., et al.,(1991), Membrane cofactor protein of the complement system: alternative splicing of serine/threonine/proline-rich exons and cytoplasmic tails produces multiple isoforms that correlate with protein phenotype.J. Exp. Med. 174:93-102.
  • Size / Price
    Catalog: HG12239-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"