Quick Order

Human CD46 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human CD46 cDNA Clone Product Information
NCBI RefSeq:BC030594
RefSeq ORF Size:1155bp
cDNA Description:Full length Clone DNA of Homo sapiens CD46 molecule, complement regulatory protein with C terminal Myc tag.
Gene Synonym:MCP, TLX, AHUS2, MIC10, TRA2.10, CD46
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

CD46, also known as Membrane Cofactor Protein (MCP), is a complement regulatory protein. CD46 is a type 1 membrane protein that plays an important inhibitory role in the complement system. CD46 is expressed in white blood cells, platelets, epithelial cells, and fibroblasts. Human CD46 shares 50% amino acid sequence identity with mouse and rat CD46. The importance of CD46 to complement regulation is underscored by the observation that genetic loss of CD46 leads to development of atypical hemolytic-uremic syndrome (aHUS), a disease characterized by uncontrolled complement activation. CD46 is implicated in the development and/or progression of selected cancer types.

References
  • Lublin D.M., et al.,(1988), Molecular cloning and chromosomal localization of human membrane cofactor protein (MCP). Evidence for inclusion in the multigene family of complement-regulatory proteins. J. Exp. Med. 168:181-194.
  • Purcell D.F., et al., (1991), Alternatively spliced RNAs encode several isoforms of CD46 (MCP), a regulator of complement activation.Immunogenetics 33:335-344.
  • Post T.W., et al.,(1991), Membrane cofactor protein of the complement system: alternative splicing of serine/threonine/proline-rich exons and cytoplasmic tails produces multiple isoforms that correlate with protein phenotype.J. Exp. Med. 174:93-102.
  • Size / Price
    Catalog: HG12239-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"