CD3G cDNA ORF Clone, Human, C-Myc tag

Cat: HG11251-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CD3G Reagents
CRO Services
Product recommended

All CD3G Reagents
CD3G cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
549 bp
Description
Full length Clone DNA of Human CD3g molecule, gamma (CD3-TCR complex) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD3G cDNA ORF Clone, Human, C-Myc tag Alternative Names
CD3-GAMMA cDNA ORF Clone, Human;IMD17 cDNA ORF Clone, Human;T3G cDNA ORF Clone, Human
CD3G Background Information

CD3G gene encodes CD3-gamma polypeptide, which together with CD3-epsilon, -delta, and -zeta, and the TCR alpha/beta and gamma/delta heterodimers, forms the TCR-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The CD3 gamma chain has long been considered to mediate targeting to lysosomes for degradation. Defects in this gene are associated with T cell immunodeficiency. Further, it has been proposed as one of the important candidate genes for cancer development due to its pivotal roles in TCR signaling pathway.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
CD3g molecule, gamma (CD3-TCR complex)
References
  • Jiang L, Xu J, Ni J, et al. A Functional Insertion/Deletion Polymorphism in the Proximal Promoter of CD3G Is Associated with Susceptibility for Hepatocellular Carcinoma in Chinese Population. DNA and Cell Biology.
  • CD3G cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD3G cDNA ORF Clone in Cloning Vector, Rhesus CG90048-G
    CD3G cDNA ORF Clone, Rhesus, untagged CG90048-UT
    CD3G cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90048-ACG
    CD3G Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90048-ACGLN
    CD3G cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90048-ACR
    CD3G cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90048-CF
    CD3G cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90048-NF
    CD3G cDNA ORF Clone, Rhesus, C-His tag CG90048-CH
    CD3G cDNA ORF Clone, Rhesus, N-His tag CG90048-NH
    CD3G cDNA ORF Clone, Rhesus, C-HA tag CG90048-CY
    CD3G cDNA ORF Clone, Rhesus, N-HA tag CG90048-NY
    CD3G cDNA ORF Clone, Rhesus, C-Myc tag CG90048-CM
    CD3G cDNA ORF Clone, Rhesus, N-Myc tag CG90048-NM

    CD3G cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD3G cDNA ORF Clone in Cloning Vector, Rat RG80314-G
    CD3G cDNA ORF Clone, Rat, untagged RG80314-UT
    CD3G Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80314-ACGLN
    CD3G cDNA ORF Clone, Rat, C-GFPSpark® tag RG80314-ACG
    CD3G cDNA ORF Clone, Rat, C-OFPSpark® tag RG80314-ACR
    CD3G cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80314-CF
    CD3G cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80314-NF
    CD3G cDNA ORF Clone, Rat, C-His tag RG80314-CH
    CD3G cDNA ORF Clone, Rat, N-His tag RG80314-NH
    CD3G cDNA ORF Clone, Rat, C-HA tag RG80314-CY
    CD3G cDNA ORF Clone, Rat, N-HA tag RG80314-NY
    CD3G cDNA ORF Clone, Rat, C-Myc tag RG80314-CM
    CD3G cDNA ORF Clone, Rat, N-Myc tag RG80314-NM
    CD3G qPCR Primer Pairs, Rat RP300287

    CD3G cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD3G cDNA ORF Clone in Cloning Vector, Mouse MG50392-M
    CD3G cDNA ORF Clone, Mouse, untagged MG50392-UT
    CD3G Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50392-ACGLN
    CD3G cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50392-ACG
    CD3G cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50392-ACR
    CD3G cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50392-CF
    CD3G cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50392-NF
    CD3G cDNA ORF Clone, Mouse, C-His tag MG50392-CH
    CD3G cDNA ORF Clone, Mouse, N-His tag MG50392-NH
    CD3G cDNA ORF Clone, Mouse, C-HA tag MG50392-CY
    CD3G cDNA ORF Clone, Mouse, N-HA tag MG50392-NY
    CD3G cDNA ORF Clone, Mouse, C-Myc tag MG50392-CM
    CD3G cDNA ORF Clone, Mouse, N-Myc tag MG50392-NM
    CD3G qPCR Primer Pairs, Mouse MP200411

    CD3G cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD3G cDNA ORF Clone in Cloning Vector, Human HG11251-M
    CD3G cDNA ORF Clone, Human, untagged HG11251-UT
    CD3G cDNA ORF Clone, Human, C-GFPSpark® tag HG11251-ACG
    CD3G Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11251-ACGLN
    CD3G cDNA ORF Clone, Human, C-OFPSpark® tag HG11251-ACR
    CD3G cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11251-CF
    CD3G cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11251-NF
    CD3G cDNA ORF Clone, Human, C-His tag HG11251-CH
    CD3G cDNA ORF Clone, Human, N-His tag HG11251-NH
    CD3G cDNA ORF Clone, Human, C-HA tag HG11251-CY
    CD3G cDNA ORF Clone, Human, N-HA tag HG11251-NY
    CD3G cDNA ORF Clone, Human, N-Myc tag HG11251-NM
    CD3G qPCR Primer Pairs, Human HP101135
    info info
    添加购物车成功! 添加购物车失败!