Quick Order

Human CD3g/CD3 gamma Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CD3G cDNA Clone Product Information
NCBI RefSeq:NM_000073.2
RefSeq ORF Size:549bp
cDNA Description:Full length Clone DNA of Homo sapiens CD3g molecule, gamma (CD3-TCR complex).
Gene Synonym:T3G, FLJ17620, FLJ17664, FLJ79544, FLJ94613, CD3-GAMMA
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CD3G
Restriction Site:KpnI + XbaI (6.1kb + 0.55kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CD3G qPCR primers for gene expression analysis, HP101135 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CD3G Gene Plasmid Map
Human CD3G Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

CD3G gene encodes CD3-gamma polypeptide, which together with CD3-epsilon, -delta, and -zeta, and the TCR alpha/beta and gamma/delta heterodimers, forms the TCR-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The CD3 gamma chain has long been considered to mediate targeting to lysosomes for degradation. Defects in this gene are associated with T cell immunodeficiency. Further, it has been proposed as one of the important candidate genes for cancer development due to its pivotal roles in TCR signaling pathway.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

References
  • Jiang L, Xu J, Ni J, et al. A Functional Insertion/Deletion Polymorphism in the Proximal Promoter of CD3G Is Associated with Susceptibility for Hepatocellular Carcinoma in Chinese Population. DNA and Cell Biology.
  • Size / Price
    Catalog: HG11251-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry
    Contact Us
    Images
    • Human CD3G Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"