After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CD3g/CD3 gamma Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CD3G cDNA Clone Product Information
NCBI RefSeq:NM_000073.2
RefSeq ORF Size:549bp
cDNA Description:Full length Clone DNA of Homo sapiens CD3g molecule, gamma (CD3-TCR complex).
Gene Synonym:T3G, FLJ17620, FLJ17664, FLJ79544, FLJ94613, CD3-GAMMA
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CD3G
Restriction Site:KpnI + XbaI (6.1kb + 0.55kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CD3G Gene Plasmid Map
Human CD3G Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG11251-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Human CD3G Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"