CD34 cDNA ORF Clone, Human, C-Myc tag

Cat: HG10097-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
Leave us a message
All CD34 Reagents
CRO Services
Product recommended
All CD34 Reagents
CD34 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
NM_001773.2
RefSeq ORF Size
987 bp
Description
Full length Clone DNA of Human CD34 molecule, transcript variant 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD34 Background Information

Cluster of Differentiation 34 (CD34) is a member of a family of single-pass transmembrane sialomucin proteins, and may function as a cell-cell adhesion factor. CD34 protein is selectively expressed on hematopoietic progenitor cells and the small vessel endothelium of a variety of tissues. It has been widely used as a stem and progenitor cell marker, and clinical CD34+ stem cell transplantation (CD34+SCT) has been performed for tumor purging. CD34 monoclonal antibodies are widely used to identify and isolate hemopoietic progenitors and to classify acute and chronic leukemias.

Full Name
CD34 molecule
Research Areas
References
  • Hogan CJ, et al. (2002) Differential long-term and multilineage engraftment potential from subfractions of human CD34+ cord blood cells transplanted into NOD/SCID mice. Proc Nat Acad Sci USA. 99 (1): 413-8.
  • Nielsen JS,et al. (2009) CD34 is a key regulator of hematopoietic stem cell trafficking to bone marrow and mast cell progenitor trafficking in the periphery. Microcirculation. 16(6): 487-96.
  • Mastrandrea F,et al. (2009) CD34+ hemopoietic precursor and stem cells traffic in peripheral blood of celiac patients is significantly increased but not directly related to epithelial damage severity. Eur Ann Allergy Clin Immunol. 40(3): 90-103.
  • Pasquet S,et al. (2009) Long-term benefit of intracardiac delivery of autologous granulocyte-colony-stimulating factor-mobilized blood CD34+ cells containing cardiac progenitors on regional heart structure and function after myocardial infarct. Cytotherapy. 11(8): 1002-15.

    • CD34 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD34 cDNA ORF Clone in Cloning Vector, Rat RG80262-G
    CD34 cDNA ORF Clone, Rat, untagged RG80262-UT
    CD34 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80262-ACGLN
    CD34 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80262-ACG
    CD34 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80262-ACR
    CD34 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80262-CF
    CD34 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80262-NF
    CD34 cDNA ORF Clone, Rat, C-His tag RG80262-CH
    CD34 cDNA ORF Clone, Rat, N-His tag RG80262-NH
    CD34 cDNA ORF Clone, Rat, C-HA tag RG80262-CY
    CD34 cDNA ORF Clone, Rat, N-HA tag RG80262-NY
    CD34 cDNA ORF Clone, Rat, C-Myc tag RG80262-CM
    CD34 cDNA ORF Clone, Rat, N-Myc tag RG80262-NM
    CD34 qPCR Primer Pairs, Rat RP300247

    CD34 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD34 cDNA ORF Clone, Mouse, untagged MG50589-UT
    CD34 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50589-ACGLN
    CD34 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50589-ACG
    CD34 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50589-ACR
    CD34 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50589-CF
    CD34 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50589-NF
    CD34 cDNA ORF Clone, Mouse, C-His tag MG50589-CH
    CD34 cDNA ORF Clone, Mouse, N-His tag MG50589-NH
    CD34 cDNA ORF Clone, Mouse, C-HA tag MG50589-CY
    CD34 cDNA ORF Clone, Mouse, N-HA tag MG50589-NY
    CD34 cDNA ORF Clone, Mouse, C-Myc tag MG50589-CM
    CD34 cDNA ORF Clone, Mouse, N-Myc tag MG50589-NM
    CD34 qPCR Primer Pairs, Mouse MP201028

    CD34 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD34 cDNA ORF Clone in Cloning Vector, Human HG10097-M
    CD34 cDNA ORF Clone in Cloning Vector, Human HG10103-M
    CD34 cDNA ORF Clone, Human, untagged HG10097-UT
    CD34 cDNA ORF Clone, Human, untagged HG10103-UT
    CD34 cDNA ORF Clone, Human, C-GFPSpark® tag HG10097-ACG
    CD34 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10103-ACGLN
    CD34 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10097-ACGLN
    CD34 cDNA ORF Clone, Human, C-GFPSpark® tag HG10103-ACG
    CD34 cDNA ORF Clone, Human, C-OFPSpark® tag HG10097-ACR
    CD34 cDNA ORF Clone, Human, C-OFPSpark® tag HG10103-ACR
    CD34 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10097-CF
    CD34 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10103-CF
    CD34 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10097-NF
    CD34 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10103-NF
    CD34 cDNA ORF Clone, Human, C-His tag HG10103-CH
    CD34 cDNA ORF Clone, Human, C-His tag HG10097-CH
    CD34 cDNA ORF Clone, Human, N-His tag HG10097-NH
    CD34 cDNA ORF Clone, Human, N-His tag HG10103-NH
    CD34 cDNA ORF Clone, Human, C-HA tag HG10103-CY
    CD34 cDNA ORF Clone, Human, C-HA tag HG10097-CY
    CD34 cDNA ORF Clone, Human, N-HA tag HG10097-NY
    CD34 cDNA ORF Clone, Human, N-HA tag HG10103-NY
    CD34 cDNA ORF Clone, Human, C-Myc tag HG10103-CM
    CD34 cDNA ORF Clone, Human, N-Myc tag HG10097-NM
    CD34 cDNA ORF Clone, Human, N-Myc tag HG10103-NM
    CD34 qPCR Primer Pairs, Human HP100178
    info info
    添加购物车成功！ 添加购物车失败！