VEGFR2 / KDR cDNA ORF Clone, Human, untagged

Cat: HG10012-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All VEGFR2 / KDR Reagents
CRO Services
Product recommended

All VEGFR2 / KDR Reagents
VEGFR2 / KDR cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
4071 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human kinase insert domain receptor (a type I II receptor tyrosine kinase).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI (6.1kb + 4.07kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
VEGFR2 / KDR cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VEGFR2 / KDR cDNA ORF Clone, Human, untagged Alternative Names
CD309 cDNA ORF Clone, Human;Flk-1 cDNA ORF Clone, Human;FLK1 cDNA ORF Clone, Human;VEGFR cDNA ORF Clone, Human;VEGFR2 cDNA ORF Clone, Human
VEGFR2 / KDR Background Information

VEGFR2, also called as KDR or Flk-1, is identified as the receptor for VEGF and VEGFC and an early marker for endothelial cell progenitors, whose expression is restricted to endothelial cells in vivo. VEGFR2 was shown to be the primary signal transducer for angiogenesis and the development of pathological conditions such as cancer and diabetic retinopathy. It has been shown that VEGFR2 is expressed mainly in the endothelial cells, and the expression is upregulated in the tumor vasculature. Thus the inhibition of VEGFR2 activity and its downstream signaling are important targets for the treatment of diseases involving angiogenesis. VEGFR2 transduces the major signals for angiogenesis via its strong tyrosine kinase activity. However, unlike other representative tyrosine kinase receptors, VEGFR2 does not use the Ras pathway as a major downstream signaling but rather uses the phospholipase C-protein kinase C pathway to signal mitogen-activated protein (MAP)-kinase activation and DNA synthesis. VEGFR2 is a direct and major signal transducer for pathological angiogenesis, including cancer and diabetic retinopathy, in cooperation with many other signaling partners; thus, VEGFR2 and its downstream signaling appear to be critical targets for the suppression of these diseases. VEGF and VEGFR2-mediated survival signaling is critical to endothelial cell survival, maintenance of the vasculature and alveolar structure and regeneration of lung tissue. Reduced VEGF and VEGFR2 expression in emphysematous lungs has been linked to increased endothelial cell death and vascular regression.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
kinase insert domain receptor
Research Areas
References
  • Shibuya M. (2006) Vascular endothelial growth factor (VEGF)-Receptor2: its biological functions, major signaling pathway, and specific ligand VEGF-E. Endothelium. 13(2): 63-9.
  • Marwick JA, et al. (2010) Cigarette smoke regulates VEGFR2-mediated survival signaling in rat lungs. J Inflamm (Lond). 7(1): 11.
  • Bruns AF, et al. (2010) Ligand-stimulated VEGFR2 signaling is regulated by co-ordinated trafficking and proteolysis. Traffic. 11(1): 161-74.
  • VEGFR2 / KDR cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    VEGFR2 / KDR cDNA ORF Clone in Cloning Vector, Rat RG80113-G
    VEGFR2 / KDR cDNA ORF Clone, Rat, untagged RG80113-UT
    VEGFR2 / KDR Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80113-ACGLN
    VEGFR2 / KDR cDNA ORF Clone, Rat, C-GFPSpark® tag RG80113-ACG
    VEGFR2 / KDR cDNA ORF Clone, Rat, C-OFPSpark® tag RG80113-ACR
    VEGFR2 / KDR cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80113-CF
    VEGFR2 / KDR cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80113-NF
    VEGFR2 / KDR cDNA ORF Clone, Rat, C-His tag RG80113-CH
    VEGFR2 / KDR cDNA ORF Clone, Rat, N-His tag RG80113-NH
    VEGFR2 / KDR cDNA ORF Clone, Rat, C-HA tag RG80113-CY
    VEGFR2 / KDR cDNA ORF Clone, Rat, N-HA tag RG80113-NY
    VEGFR2 / KDR cDNA ORF Clone, Rat, C-Myc tag RG80113-CM
    VEGFR2 / KDR cDNA ORF Clone, Rat, N-Myc tag RG80113-NM
    VEGFR2 / KDR qPCR Primer Pairs, Rat RP300108

    VEGFR2 / KDR cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    VEGFR2 / KDR cDNA ORF Clone in Cloning Vector, Mouse MG50998-G
    VEGFR2 / KDR cDNA ORF Clone, Mouse, untagged MG50998-UT
    VEGFR2 / KDR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50998-ACG
    VEGFR2 / KDR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50998-ACGLN
    VEGFR2 / KDR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50998-ACR
    VEGFR2 / KDR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50998-CF
    VEGFR2 / KDR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50998-NF
    VEGFR2 / KDR cDNA ORF Clone, Mouse, C-His tag MG50998-CH
    VEGFR2 / KDR cDNA ORF Clone, Mouse, N-His tag MG50998-NH
    VEGFR2 / KDR cDNA ORF Clone, Mouse, C-HA tag MG50998-CY
    VEGFR2 / KDR cDNA ORF Clone, Mouse, N-HA tag MG50998-NY
    VEGFR2 / KDR cDNA ORF Clone, Mouse, C-Myc tag MG50998-CM
    VEGFR2 / KDR cDNA ORF Clone, Mouse, N-Myc tag MG50998-NM
    VEGFR2 / KDR qPCR Primer Pairs, Mouse MP200963

    VEGFR2 / KDR cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    VEGFR2 / KDR cDNA ORF Clone in Cloning Vector, Human HG10012-M
    VEGFR2 / KDR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10012-ACGLN
    VEGFR2 / KDR cDNA ORF Clone, Human, C-GFPSpark® tag HG10012-ACG
    VEGFR2 / KDR cDNA ORF Clone, Human, C-OFPSpark® tag HG10012-ACR
    VEGFR2 / KDR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10012-CF
    VEGFR2 / KDR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10012-NF
    VEGFR2 / KDR cDNA ORF Clone, Human, C-His tag HG10012-CH
    VEGFR2 / KDR cDNA ORF Clone, Human, N-His tag HG10012-NH
    VEGFR2 / KDR cDNA ORF Clone, Human, C-HA tag HG10012-CY
    VEGFR2 / KDR cDNA ORF Clone, Human, N-HA tag HG10012-NY
    VEGFR2 / KDR cDNA ORF Clone, Human, C-Myc tag HG10012-CM
    VEGFR2 / KDR cDNA ORF Clone, Human, N-Myc tag HG10012-NM
    VEGFR2 / KDR qPCR Primer Pairs, Human HP100109
    info info
    添加购物车成功! 添加购物车失败!