CD30 cDNA ORF Clone, Human, N-His tag

Cat: HG10777-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD30 Reagents
CRO Services
Product recommended

All CD30 Reagents
CD30 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1788 bp
Description
Full length Clone DNA of Human tumor necrosis factor receptor superfamily, member 8 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD30 cDNA ORF Clone, Human, N-His tag Alternative Names
CD30 cDNA ORF Clone, Human;D1S166E cDNA ORF Clone, Human;Ki-1 cDNA ORF Clone, Human
CD30 Background Information

CD30, also known as TNFRSF8, is a cell membrane protein of the tumor necrosis factor receptor (TNFR) superfamily. CD30 protein is expressed by activated, but not resting, T and B cells. CD30 can regulate proliferation of lymphocytes and may also play an important role in human immunodeficiency virus replication. As a regulator of apoptosis, CD30 protein induces cell death or proliferation, depending on the cell type, and has been shown to limit the proliferative potential of autoreactive CD8 effector T cells and protect the body against autoimmunity. CD30 protein expression is upregulated in various hematological malignancies, including Reed-Sternberg cells in Hodgkin's disease (HD), anaplastic large cell lymphoma (ALCL) and subsets of Non-Hodgkin's lymphomas (NHLs), and CD30 is also linked to leukocytes in patients with chronic inflammatory diseases, including lupus erythematosus, asthma, rheumatoid arthritis and atopic dermatitis (AD).

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
tumor necrosis factor receptor superfamily, member 8
Research Areas
References
  • Rossi FM, et al. (2001) CD30L up-regulates CD30 and IL-4 expression by T cells. FEBS Lett. 508(3): 418-22.
  • Trovato M, et al. (2001) Expression of CD30 ligand and CD30 receptor in normal thyroid and benign and malignant thyroid nodules. Thyroid. 11(7): 621-8.
  • Ekstrom ES, et al. (2001) Presence of CD30(+) and CD30L(+) cells in human placenta and soluble CD30 levels in cord blood are independent of maternal atopy. Placenta. 22(4): 372-9.
  • Tang C, et al. (2008) A novel role of CD30L/CD30 signaling by T-T cell interaction in Th1 response against mycobacterial infection. J Immunol. 181(9): 6316-27.
  • Sun X, et al. (2008) A critical role of CD30 ligand/CD30 in controlling inflammatory bowel diseases in mice. Gastroenterology. 134(2): 447-58.
  • Oflazoglu E, et al. (2009) Targeting CD30/CD30L in Oncology and Autoimmune and Inflammatory Diseases.Adv Exp Med Biol. 647: 174-85.
  • info info
    添加购物车成功! 添加购物车失败!