Quick Order

Human CD30/TNFRSF8 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human TNFRSF8 cDNA Clone Product Information
NCBI RefSeq:NM_001243.3
RefSeq ORF Size:1788bp
cDNA Description:Full length Clone DNA of Homo sapiens tumor necrosis factor receptor superfamily, member 8.
Gene Synonym:CD30, KI-1, D1S166E
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-TNFRSF8
Restriction Site:KpnI + XbaI (6.1kb + 1.79kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

CD30, also known as TNFRSF8, is a cell membrane protein of the tumor necrosis factor receptor (TNFR) superfamily. CD30 protein is expressed by activated, but not resting, T and B cells. CD30 can regulate proliferation of lymphocytes and may also play an important role in human immunodeficiency virus replication. As a regulator of apoptosis, CD30 protein induces cell death or proliferation, depending on the cell type, and has been shown to limit the proliferative potential of autoreactive CD8 effector T cells and protect the body against autoimmunity. CD30 protein expression is upregulated in various hematological malignancies, including Reed-Sternberg cells in Hodgkin's disease (HD), anaplastic large cell lymphoma (ALCL) and subsets of Non-Hodgkin's lymphomas (NHLs), and CD30 is also linked to leukocytes in patients with chronic inflammatory diseases, including lupus erythematosus, asthma, rheumatoid arthritis and atopic dermatitis (AD).

References
  • Rossi FM, et al. (2001) CD30L up-regulates CD30 and IL-4 expression by T cells. FEBS Lett. 508(3): 418-22.
  • Trovato M, et al. (2001) Expression of CD30 ligand and CD30 receptor in normal thyroid and benign and malignant thyroid nodules. Thyroid. 11(7): 621-8.
  • Ekstrom ES, et al. (2001) Presence of CD30(+) and CD30L(+) cells in human placenta and soluble CD30 levels in cord blood are independent of maternal atopy. Placenta. 22(4): 372-9.
  • Tang C, et al. (2008) A novel role of CD30L/CD30 signaling by T-T cell interaction in Th1 response against mycobacterial infection. J Immunol. 181(9): 6316-27.
  • Sun X, et al. (2008) A critical role of CD30 ligand/CD30 in controlling inflammatory bowel diseases in mice. Gastroenterology. 134(2): 447-58.
  • Oflazoglu E, et al. (2009) Targeting CD30/CD30L in Oncology and Autoimmune and Inflammatory Diseases.Adv Exp Med Biol. 647: 174-85.
  • Size / Price
    Catalog: HG10777-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"