Quick Order

Human CD30 / TNFRSF8 ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human TNFRSF8 cDNA Clone Product Information
NCBI RefSeq:NM_001243.3
RefSeq ORF Size:1788bp
cDNA Description:Full length Clone DNA of Homo sapiens tumor necrosis factor receptor superfamily, member 8 with N terminal His tag.
Gene Synonym:CD30, KI-1, D1S166E
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

CD30, also known as TNFRSF8, is a cell membrane protein of the tumor necrosis factor receptor (TNFR) superfamily. CD30 protein is expressed by activated, but not resting, T and B cells. CD30 can regulate proliferation of lymphocytes and may also play an important role in human immunodeficiency virus replication. As a regulator of apoptosis, CD30 protein induces cell death or proliferation, depending on the cell type, and has been shown to limit the proliferative potential of autoreactive CD8 effector T cells and protect the body against autoimmunity. CD30 protein expression is upregulated in various hematological malignancies, including Reed-Sternberg cells in Hodgkin's disease (HD), anaplastic large cell lymphoma (ALCL) and subsets of Non-Hodgkin's lymphomas (NHLs), and CD30 is also linked to leukocytes in patients with chronic inflammatory diseases, including lupus erythematosus, asthma, rheumatoid arthritis and atopic dermatitis (AD).

References
  • Rossi FM, et al. (2001) CD30L up-regulates CD30 and IL-4 expression by T cells. FEBS Lett. 508(3): 418-22.
  • Trovato M, et al. (2001) Expression of CD30 ligand and CD30 receptor in normal thyroid and benign and malignant thyroid nodules. Thyroid. 11(7): 621-8.
  • Ekstrom ES, et al. (2001) Presence of CD30(+) and CD30L(+) cells in human placenta and soluble CD30 levels in cord blood are independent of maternal atopy. Placenta. 22(4): 372-9.
  • Tang C, et al. (2008) A novel role of CD30L/CD30 signaling by T-T cell interaction in Th1 response against mycobacterial infection. J Immunol. 181(9): 6316-27.
  • Sun X, et al. (2008) A critical role of CD30 ligand/CD30 in controlling inflammatory bowel diseases in mice. Gastroenterology. 134(2): 447-58.
  • Oflazoglu E, et al. (2009) Targeting CD30/CD30L in Oncology and Autoimmune and Inflammatory Diseases.Adv Exp Med Biol. 647: 174-85.
  • Size / Price
    Catalog: HG10777-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeks
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"