Text Size:AAA

Human CD2AP Gene ORF cDNA clone expression plasmid, C-HA tag

  • Human CD2AP Gene Expression validated Image 16882
  • Human CD2AP ORF mammalian expression plasmid, C-HA tag
DatasheetReviewsRelated ProductsProtocols
Human CD2AP cDNA Clone Product Information
NCBI RefSeq:NM_012120.2
RefSeq ORF Size:1920bp
cDNA Description:Full length Clone DNA of Human CD2-associated protein with C terminal HA tag.
Gene Synonym:CMS, DKFZp586H0519, CD2AP
Species:Human
Vector:pCMV3-C-HA
Plasmid:pCMV3-CD2AP-HA
Restriction Site:KpnI+NotI (6kb+1.96kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1204 C/T not causing the amino acid variation.
Sequencing primers:T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
( We provide with CD2AP qPCR primers for gene expression analysis, HP102011 )
Promoter:Enhanced CMV cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CD2AP Gene Plasmid Map
Human CD2AP ORF mammalian expression plasmid, C-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"