CD26 cDNA ORF Clone, Human, untagged

Cat: HG10688-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD26 Reagents
CRO Services
Product recommended

All CD26 Reagents
CD26 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2301 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human dipeptidyl-peptidase 4.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI (6.1kb + 2.3kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CD26 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD26 cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
CD26 cDNA ORF Clone, Human, untagged Alternative Names
ADABP cDNA ORF Clone, Human;ADCP2 cDNA ORF Clone, Human;CD26 cDNA ORF Clone, Human;DPPIV cDNA ORF Clone, Human;TP103 cDNA ORF Clone, Human
CD26 Background Information

Dipeptidyl peptidase-4 (DPP4) or adenosine deaminase complexing protein 2 (ADCP 2) or T-cell activation antigen CD26 is a serine exopeptidase belonging to the S9B protein family that cleaves X-proline dipeptides from the N-terminus of polypeptides, such as chemokines, neuropeptides, and peptide hormones. The enzyme is a type II transmembrane glycoprotein, expressed on the surface of many cell types. It is also present in serum and other body fluids in a truncated form (sCD26/DPPIV). The soluble CD26 (sCD26) as a tumour marker for the detection of colorectal cancer (CRC) and advanced adenomas. As both a regulatory enzyme and a signalling factor, DPP4 has been evaluated and described in many studies. DPP4 inhibition results in increased blood concentration of the incretin hormones glucagon-like peptide-1 (GLP-1) and gastric inhibitory polypeptide (GIP). This causes an increase in glucose-dependent stimulation, resulting in a lowering of blood glucose levels. Recent studies have shown that DPP4 inhibitors can induce a significant reduction in glycosylated haemoglobin (HbA(1c)) levels, either as monotherapy or as a combination with other antidiabetic agents. Research has also demonstrated that DPP4 inhibitors portray a very low risk of hypoglycaemia development, and are a new pharmacological class of drugs for treating Type 2 diabetes.

Full Name
dipeptidylpeptidase 4
References
  • Doupis J, et al. (2008) DPP4 inhibitors: a new approach in diabetes treatment. Adv Ther. 25(7): 627-43.
  • Havre PA, et al. (2008) The role of CD26/dipeptidyl peptidase IV in cancer. Front Biosci. 13: 1634-45.
  • De Chiara L, et al. (2009) Soluble CD26 levels and its association to epidemiologic parameters in a sample population. Dis Markers. 7(6): 311-6.
  • Matteucci E, et al. (2009) Dipeptidyl peptidase-4 (CD26): knowing the function before inhibiting the enzyme. Curr Med Chem. 16(23): 2943-51.
  • CD26 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD26 cDNA ORF Clone in Cloning Vector, Rhesus CG90180-G
    CD26 cDNA ORF Clone, Rhesus, untagged CG90180-UT
    CD26 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90180-ACGLN
    CD26 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90180-ACG
    CD26 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90180-ACR
    CD26 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90180-CF
    CD26 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90180-NF
    CD26 cDNA ORF Clone, Rhesus, C-His tag CG90180-CH
    CD26 cDNA ORF Clone, Rhesus, N-His tag CG90180-NH
    CD26 cDNA ORF Clone, Rhesus, C-HA tag CG90180-CY
    CD26 cDNA ORF Clone, Rhesus, N-HA tag CG90180-NY
    CD26 cDNA ORF Clone, Rhesus, C-Myc tag CG90180-CM
    CD26 cDNA ORF Clone, Rhesus, N-Myc tag CG90180-NM

    CD26 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD26 cDNA ORF Clone in Cloning Vector, Rat RG80289-G
    CD26 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80289-ACGLN

    CD26 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD26 cDNA ORF Clone in Cloning Vector, Mouse MG50718-G
    CD26 cDNA ORF Clone, Mouse, untagged MG50718-UT
    CD26 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50718-ACGLN
    CD26 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50718-ACG
    CD26 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50718-ACR
    CD26 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50718-CF
    CD26 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50718-NF
    CD26 cDNA ORF Clone, Mouse, C-His tag MG50718-CH
    CD26 cDNA ORF Clone, Mouse, N-His tag MG50718-NH
    CD26 cDNA ORF Clone, Mouse, C-HA tag MG50718-CY
    CD26 cDNA ORF Clone, Mouse, N-HA tag MG50718-NY
    CD26 cDNA ORF Clone, Mouse, C-Myc tag MG50718-CM
    CD26 cDNA ORF Clone, Mouse, N-Myc tag MG50718-NM
    CD26 qPCR Primer Pairs, Mouse MP200693

    CD26 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD26 cDNA ORF Clone in Cloning Vector, Human HG10688-M
    CD26 cDNA ORF Clone, Human, C-GFPSpark® tag HG10688-ACG
    CD26 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10688-ACGLN
    CD26 cDNA ORF Clone, Human, C-OFPSpark® tag HG10688-ACR
    CD26 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10688-CF
    CD26 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10688-NF
    CD26 cDNA ORF Clone, Human, C-His tag HG10688-CH
    CD26 cDNA ORF Clone, Human, N-His tag HG10688-NH
    CD26 cDNA ORF Clone, Human, C-HA tag HG10688-CY
    CD26 cDNA ORF Clone, Human, N-HA tag HG10688-NY
    CD26 cDNA ORF Clone, Human, C-Myc tag HG10688-CM
    CD26 cDNA ORF Clone, Human, N-Myc tag HG10688-NM
    CD26 qPCR Primer Pairs, Human HP100649
    info info
    添加购物车成功! 添加购物车失败!