CD3 zeta cDNA ORF Clone, Human, N-His tag

Cat: HG13142-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD3 zeta Reagents
CRO Services
Product recommended

All CD3 zeta Reagents
CD3 zeta cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
495 bp
Description
Full length Clone DNA of Human CD247 molecule with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD3 zeta cDNA ORF Clone, Human, N-His tag Alternative Names
CD3-ZETA cDNA ORF Clone, Human;CD3H cDNA ORF Clone, Human;CD3Q cDNA ORF Clone, Human;CD3Z cDNA ORF Clone, Human;IMD25 cDNA ORF Clone, Human;T3Z cDNA ORF Clone, Human;TCRZ cDNA ORF Clone, Human
CD3 zeta Background Information

CD247, also known as CD3-ZETA, belongs to the CD3Z/FCER1G family. It contains 3 ITAM domains. As a -cell receptor zeta, CD247 forms the T-cell receptor-CD3 complex together with T-cell receptor alpha/beta and gamma/delta heterodimers, and with CD3-gamma, -delta and –epsilon. The zeta chain plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. Low expression of the antigen results in impaired immune response. Two alternatively spliced transcript variants encoding distinct isoforms have been found for CD247 gene. Defects in CD247 can cause immunodeficiency due to defect in CD3-zeta. An immunological deficiency characterized by T-cells impaired immune response to alloantigens, tetanus toxoid and mitogens. CD247 may play a role in assembly and expression of the TCR complex as well as signal transduction upon antigen triggering.

Full Name
CD247 molecule
References
  • 1. Radstake TR, et al. (2010) Genome-wide association study of systemic sclerosis identifies CD247 as a new susceptibility locus. Nat Genet. 42(5):426-9.
  • 2. Dieud P, et al. (2011) Independent replication establishes the CD247 gene as a genetic systemic sclerosis susceptibility factor. Ann Rheum Dis. 70(9):1695-6.
  • 3. Li R, et al. (2012) Association of CD247 with systemic lupus erythematosus in Asian populations. Lupus. 21(1):75-83.
  • CD3 zeta cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD3 zeta cDNA ORF Clone in Cloning Vector, Rhesus CG90248-G
    CD3 zeta cDNA ORF Clone, Rhesus, untagged CG90248-UT
    CD3 zeta cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90248-ACG
    CD3 zeta Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90248-ACGLN
    CD3 zeta cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90248-ACR
    CD3 zeta cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90248-CF
    CD3 zeta cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90248-NF
    CD3 zeta cDNA ORF Clone, Rhesus, C-His tag CG90248-CH
    CD3 zeta cDNA ORF Clone, Rhesus, N-His tag CG90248-NH
    CD3 zeta cDNA ORF Clone, Rhesus, C-HA tag CG90248-CY
    CD3 zeta cDNA ORF Clone, Rhesus, N-HA tag CG90248-NY
    CD3 zeta cDNA ORF Clone, Rhesus, C-Myc tag CG90248-CM
    CD3 zeta cDNA ORF Clone, Rhesus, N-Myc tag CG90248-NM

    CD3 zeta cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD3 zeta cDNA ORF Clone in Cloning Vector, Rat RG80391-G
    CD3 zeta cDNA ORF Clone, Rat, untagged RG80391-UT
    CD3 zeta cDNA ORF Clone, Rat, C-GFPSpark® tag RG80391-ACG
    CD3 zeta Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80391-ACGLN
    CD3 zeta cDNA ORF Clone, Rat, C-OFPSpark® tag RG80391-ACR
    CD3 zeta cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80391-CF
    CD3 zeta cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80391-NF
    CD3 zeta cDNA ORF Clone, Rat, C-His tag RG80391-CH
    CD3 zeta cDNA ORF Clone, Rat, N-His tag RG80391-NH
    CD3 zeta cDNA ORF Clone, Rat, C-HA tag RG80391-CY
    CD3 zeta cDNA ORF Clone, Rat, N-HA tag RG80391-NY
    CD3 zeta cDNA ORF Clone, Rat, C-Myc tag RG80391-CM
    CD3 zeta cDNA ORF Clone, Rat, N-Myc tag RG80391-NM
    CD3 zeta qPCR Primer Pairs, Rat RP300357

    CD3 zeta cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD3 zeta cDNA ORF Clone in Cloning Vector, Human HG13142-G
    CD3 zeta cDNA ORF Clone, Human, untagged HG13142-UT
    CD3 zeta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13142-ACGLN
    CD3 zeta cDNA ORF Clone, Human, C-GFPSpark® tag HG13142-ACG
    CD3 zeta cDNA ORF Clone, Human, C-OFPSpark® tag HG13142-ACR
    CD3 zeta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13142-CF
    CD3 zeta cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13142-NF
    CD3 zeta cDNA ORF Clone, Human, C-His tag HG13142-CH
    CD3 zeta cDNA ORF Clone, Human, C-HA tag HG13142-CY
    CD3 zeta cDNA ORF Clone, Human, N-HA tag HG13142-NY
    CD3 zeta cDNA ORF Clone, Human, C-Myc tag HG13142-CM
    CD3 zeta cDNA ORF Clone, Human, N-Myc tag HG13142-NM
    CD3 zeta qPCR Primer Pairs, Human HP101761
    info info
    添加购物车成功! 添加购物车失败!