DC-SIGN cDNA ORF Clone, Human, N-Myc tag

Cat: HG10200-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DC-SIGN Reagents
CRO Services
Product recommended

All DC-SIGN Reagents
DC-SIGN cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1215 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CD209 molecule with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Restriction Sites
HindIII + XbaI (6kb + 1.31kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
DC-SIGN cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DC-SIGN cDNA ORF Clone, Human, N-Myc tag Validated Images
Human HER2/ERBB2 Gene Plasmid Map 5632
DC-SIGN cDNA ORF Clone, Human, N-Myc tag Alternative Names
CD209 cDNA ORF Clone, Human;CDSIGN cDNA ORF Clone, Human;CLEC4L cDNA ORF Clone, Human;DC-SIGN cDNA ORF Clone, Human;DC-SIGN1 cDNA ORF Clone, Human;MGC129965 cDNA ORF Clone, Human
DC-SIGN Background Information

Dendritic cell (DC)-specific intercellular adhesion molecule 3 (ICAM-3) grabbing nonintegrin (DC-SIGN), also known as CD209, is a type II transmembrane protein on DCs with a C-type lectin extracellular domain, is capable of binding ICAM-3 on resting T cells in the secondary lymphoid organs, providing the initial contact between these cells during the establishment of cell-mediated immunity. It is not only a pattern recognition receptor but implicated in immunoregulation of DCs. It has important role in mediating DC adhesion, migration, inflammation, activating primary T cell, triggering immune response and participating in immune escape of pathogens and tumors. DC-SIGN also mediates capture and internalization of viral, bacterial, and fungal pathogens by dendritic cells, such as HIV-1, Ebola virus, cytomegalovirus, Dengue virus, and hepatitis C virus. DC-SIGN is unique in that it regulates adhesion processes, such as DC trafficking and T-cell synapse formation, as well as antigen capture. Moreover, even though several C-type lectins have been shown to bind HIV-1, DC-SIGN does not only capture HIV-1 but also protects it in early endosomes allowing HIV-1 transport by DC to lymphoid tissues, where it enhances trans infection of T cells.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
CD209 molecule
References
  • Geijtenbeek TB, et al. (2002) DC-SIGN, a C-type lectin on dendritic cells that unveils many aspects of dendritic cell biology. J Leukoc Biol. 71(6): 921-31.
  • Masso M. (2003) DC-SIGN points the way to a novel mechanism for HIV-1 transmission. MedGenMed. 5(2): 2.
  • Zhou T, et al. (2006) DC-SIGN and immunoregulation. Cell Mol Immunol. 3(4): 279-83.
  • DC-SIGN cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    DC-SIGN cDNA ORF Clone in Cloning Vector, Rhesus CG90319-G
    DC-SIGN cDNA ORF Clone, Rhesus, untagged CG90319-UT
    DC-SIGN Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90319-ACGLN
    DC-SIGN cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90319-ACG
    DC-SIGN cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90319-ACR
    DC-SIGN cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90319-CF
    DC-SIGN cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90319-NF
    DC-SIGN cDNA ORF Clone, Rhesus, C-His tag CG90319-CH
    DC-SIGN cDNA ORF Clone, Rhesus, N-His tag CG90319-NH
    DC-SIGN cDNA ORF Clone, Rhesus, C-HA tag CG90319-CY
    DC-SIGN cDNA ORF Clone, Rhesus, N-HA tag CG90319-NY
    DC-SIGN cDNA ORF Clone, Rhesus, C-Myc tag CG90319-CM
    DC-SIGN cDNA ORF Clone, Rhesus, N-Myc tag CG90319-NM

    DC-SIGN cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    DC-SIGN cDNA ORF Clone in Cloning Vector, Human HG10200-M
    DC-SIGN cDNA ORF Clone, Human, untagged HG10200-UT
    DC-SIGN cDNA ORF Clone, Human, C-GFPSpark® tag HG10200-ACG
    DC-SIGN Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10200-ACGLN
    DC-SIGN cDNA ORF Clone, Human, C-OFPSpark® tag HG10200-ACR
    DC-SIGN cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10200-CF
    DC-SIGN cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10200-NF
    DC-SIGN cDNA ORF Clone, Human, C-His tag HG10200-CH
    DC-SIGN cDNA ORF Clone, Human, N-His tag HG10200-NH
    DC-SIGN cDNA ORF Clone, Human, C-HA tag HG10200-CY
    DC-SIGN cDNA ORF Clone, Human, N-HA tag HG10200-NY
    DC-SIGN cDNA ORF Clone, Human, C-Myc tag HG10200-CM
    DC-SIGN qPCR Primer Pairs, Human HP100263
    info info
    添加购物车成功! 添加购物车失败!