Text Size:AAA

Human CD200RLa Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human CD200R1L cDNA Clone Product Information
    NCBI RefSeq:NM_001008784.2
    RefSeq ORF Size:816bp
    cDNA Description:Full length Clone DNA of Homo sapiens CD200 receptor 1-like.
    Gene Synonym:CD200R2, CD200RLa, CD200R1L
    Species:Human
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CD200R1L qPCR primers for gene expression analysis, HP101441 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Background

    Cell surface glycoprotein CD200 receptor 2, also known as Cell surface glycoprotein CD200 receptor 1-like, Cell surface glycoprotein OX2 receptor 2, CD200 receptor-like 2, CD200Rla, CD200R1L and CD200R2, is a single-pass type I  membrane protein which belongs to the CD200R family. CD200R1L / CD200R2. It contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. CD200 is a transmembrane protein delivering immunoregulatory signals after engagement of CD200R. A family of CD200Rs exist ( CD200R1, CD200R2, CD200R3, CD200R4 ) with different tissue expression and functional activity. In the presence of anti-CD200R2 / CD200R3 monoclonal antibodies (mAbs), bone-marrow cells cultured in the presence of (interleukin [IL]-4+granulocyte-macrophage colony-stimulating factor) differentiate into dendritic cells (DCs), which induce CD4+CD25+ Treg. Interaction between the relatively ubiquitously expressed molecule CD200 and one of its receptors, CD200R1, resulted in direct suppression of alloreactivity, engagement of alternate receptors led instead to altered differentiation of dendritic cells (DCs) from marrow precursors, which could in turn foster development of Foxp3(+) regulatory T cells. Unlike anti-CD200R1, anti-CD200R2 both promotes development of DCs with capacity to induce Treg and directly augments thymocyte production of Treg.

    Size / Price
    Catalog: HG11620-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"