CD200R cDNA ORF Clone, Human, N-HA tag

Cat: HG11218-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD200R Reagents
CRO Services
Product recommended

All CD200R Reagents
CD200R cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1047 bp
Description
Full length Clone DNA of Human CD200 receptor 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD200R cDNA ORF Clone, Human, N-HA tag Alternative Names
CD200R cDNA ORF Clone, Human;HCRTR2 cDNA ORF Clone, Human;MOX2R cDNA ORF Clone, Human;OX2R cDNA ORF Clone, Human
CD200R Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cell surface glycoprotein CD200 receptor 1 (CD200R1) is an isoform of CD200 receptors which is expressed on cells of the myeloid lineage. CD200R1 is a receptor for the OX-2 membrane glycoprotein. The receptor-substrate interaction may serve as a myeloid downregulatory signal.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
CD200 receptor 1
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • CD200R cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD200R cDNA ORF Clone in Cloning Vector, Rat RG85036-U
    CD200R Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85036-ACGLN

    CD200R cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD200R cDNA ORF Clone in Cloning Vector, Mouse MG50209-M
    CD200R cDNA ORF Clone, Mouse, untagged MG50209-UT
    CD200R Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50209-ACGLN
    CD200R cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50209-ACG
    CD200R cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50209-ACR
    CD200R cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50209-CF
    CD200R cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50209-NF
    CD200R cDNA ORF Clone, Mouse, C-His tag MG50209-CH
    CD200R cDNA ORF Clone, Mouse, N-His tag MG50209-NH
    CD200R cDNA ORF Clone, Mouse, C-HA tag MG50209-CY
    CD200R cDNA ORF Clone, Mouse, N-HA tag MG50209-NY
    CD200R cDNA ORF Clone, Mouse, C-Myc tag MG50209-CM
    CD200R cDNA ORF Clone, Mouse, N-Myc tag MG50209-NM
    CD200R qPCR Primer Pairs, Mouse MP200237

    CD200R cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD200R cDNA ORF Clone in Cloning Vector, Human HG11218-M
    CD200R cDNA ORF Clone, Human, untagged HG11218-UT
    CD200R Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11218-ACGLN
    CD200R cDNA ORF Clone, Human, C-GFPSpark® tag HG11218-ACG
    CD200R cDNA ORF Clone, Human, C-OFPSpark® tag HG11218-ACR
    CD200R cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11218-CF
    CD200R cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11218-NF
    CD200R cDNA ORF Clone, Human, C-His tag HG11218-CH
    CD200R cDNA ORF Clone, Human, N-His tag HG11218-NH
    CD200R cDNA ORF Clone, Human, C-HA tag HG11218-CY
    CD200R cDNA ORF Clone, Human, C-Myc tag HG11218-CM
    CD200R cDNA ORF Clone, Human, N-Myc tag HG11218-NM
    CD200R qPCR Primer Pairs, Human HP101119
    info info
    添加购物车成功! 添加购物车失败!