CD200 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10886-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD200 Reagents
CRO Services
Product recommended

All CD200 Reagents
CD200 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
810 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CD200 molecule with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Restriction Sites
KpnI + XbaI (6kb + 0.81kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CD200 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD200 cDNA ORF Clone, Human, N-Myc tag Validated Images
Ferret CD3e/CD3 epsilon Gene Plasmid Map 5630
CD200 cDNA ORF Clone, Human, N-Myc tag Alternative Names
MOX1 cDNA ORF Clone, Human;MOX2 cDNA ORF Clone, Human;MRC cDNA ORF Clone, Human;OX-2 cDNA ORF Clone, Human;OX2 cDNA ORF Clone, Human
CD200 Background Information

CD200 (OX-2) is a cell surface glycoprotein that imparts immune privileges by suppressing alloimmune and autoimmune responses through its receptor, CD200R, expressed primarily on myeloid cells. Signals delivered through the CD200:CD200R axis have been shown to play an important role in the regulation of anti-tumor immunity, and overexpression of CD200 has been reported in a number of malignancies, including CLL, as well as on cancer stem cells. The role of CD200-CD200R signaling in immune regulation of the central nervous system has become a popular field of research in recent years. Many studies have shown that there is a close correlation between CD200-CD200R, microglia activation, and Parkinson's disease (PD). The ability of CD200 to suppress myeloid cell activation is critical for maintaining normal tissue homeostasis but may also enhance the survival of migratory neoplastic cells. CD200 and CD200R associate via their respective N-terminal Ig-like domains. CD200 has been characterized as an important immunoregulatory molecule, increased expression of which can lead to decreased transplant rejection, autoimmunity, and allergic disease. Elevated CD200 expression has been reported to be associated with poor prognosis in a number of human malignancies. In addition, CD200 also plays an important role in prevention of graft rejection, autoimmune diseases and spontaneous abortion.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
Cd200 molecule
References
  • Minas K, et al. (2006) Is the CD200/CD200 receptor interaction more than just a myeloid cell inhibitory signal? Crit Rev Immunol. 26(3): 213-30.
  • Wang XJ, et al. (2007) CD200-CD200R regulation of microglia activation in the pathogenesis of Parkinson's disease. J Neuroimmune Pharmacol. 2(3): 259-64.
  • Wong KK, et al. (2010) The role of CD200 in immunity to B cell lymphoma. J Leukoc Biol. 88(2): 361-72.
  • CD200 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD200 cDNA ORF Clone in Cloning Vector, Rhesus CG90230-G
    CD200 cDNA ORF Clone, Rhesus, untagged CG90230-UT
    CD200 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90230-ACGLN
    CD200 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90230-ACG
    CD200 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90230-ACR
    CD200 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90230-CF
    CD200 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90230-NF
    CD200 cDNA ORF Clone, Rhesus, C-His tag CG90230-CH
    CD200 cDNA ORF Clone, Rhesus, N-His tag CG90230-NH
    CD200 cDNA ORF Clone, Rhesus, C-HA tag CG90230-CY
    CD200 cDNA ORF Clone, Rhesus, N-HA tag CG90230-NY
    CD200 cDNA ORF Clone, Rhesus, C-Myc tag CG90230-CM
    CD200 cDNA ORF Clone, Rhesus, N-Myc tag CG90230-NM

    CD200 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD200 cDNA ORF Clone in Cloning Vector, Rat RG83877-U
    CD200 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83877-ACGLN

    CD200 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD200 cDNA ORF Clone in Cloning Vector, Mouse MG50074-M
    CD200 cDNA ORF Clone, Mouse, untagged MG50074-UT
    CD200 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50074-ACG
    CD200 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50074-ACGLN
    CD200 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50074-ACR
    CD200 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50074-CF
    CD200 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50074-NF
    CD200 cDNA ORF Clone, Mouse, C-His tag MG50074-CH
    CD200 cDNA ORF Clone, Mouse, N-His tag MG50074-NH
    CD200 cDNA ORF Clone, Mouse, C-HA tag MG50074-CY
    CD200 cDNA ORF Clone, Mouse, N-HA tag MG50074-NY
    CD200 cDNA ORF Clone, Mouse, C-Myc tag MG50074-CM
    CD200 cDNA ORF Clone, Mouse, N-Myc tag MG50074-NM
    CD200 qPCR Primer Pairs, Mouse MP200105

    CD200 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD200 cDNA ORF Clone in Cloning Vector, Human HG10886-M
    CD200 cDNA ORF Clone, Human, untagged HG10886-UT
    CD200 cDNA ORF Clone, Human, C-GFPSpark® tag HG10886-ACG
    CD200 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10886-ACGLN
    CD200 cDNA ORF Clone, Human, C-OFPSpark® tag HG10886-ACR
    CD200 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10886-CF
    CD200 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10886-NF
    CD200 cDNA ORF Clone, Human, C-His tag HG10886-CH
    CD200 cDNA ORF Clone, Human, N-His tag HG10886-NH
    CD200 cDNA ORF Clone, Human, C-HA tag HG10886-CY
    CD200 cDNA ORF Clone, Human, N-HA tag HG10886-NY
    CD200 cDNA ORF Clone, Human, C-Myc tag HG10886-CM
    CD200 qPCR Primer Pairs, Human HP100772
    info info
    添加购物车成功! 添加购物车失败!