CD163 cDNA ORF Clone, Human, N-His tag

Cat: HG10831-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD163 Reagents
CRO Services
Product recommended

All CD163 Reagents
CD163 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3366 bp
Description
Full length Clone DNA of Human CD163 molecule , transcript variant 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD163 cDNA ORF Clone, Human, N-His tag Alternative Names
M130 cDNA ORF Clone, Human;MM130 cDNA ORF Clone, Human
CD163 Background Information
Full Name
CD163 molecule

CD163 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CD163 cDNA ORF Clone in Cloning Vector, Mouse MG51057-G
CD163 cDNA ORF Clone, Mouse, untagged MG51057-UT
CD163 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51057-ACG
CD163 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51057-ACGLN
CD163 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51057-ACR
CD163 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51057-CF
CD163 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51057-NF
CD163 cDNA ORF Clone, Mouse, C-His tag MG51057-CH
CD163 cDNA ORF Clone, Mouse, N-His tag MG51057-NH
CD163 cDNA ORF Clone, Mouse, C-HA tag MG51057-CY
CD163 cDNA ORF Clone, Mouse, N-HA tag MG51057-NY
CD163 cDNA ORF Clone, Mouse, C-Myc tag MG51057-CM
CD163 cDNA ORF Clone, Mouse, N-Myc tag MG51057-NM
CD163 qPCR Primer Pairs, Mouse MP201015

CD163 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CD163 cDNA ORF Clone in Cloning Vector, Human HG10831-M
CD163 cDNA ORF Clone, Human, untagged HG10831-UT
CD163 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10831-ACGLN
CD163 cDNA ORF Clone, Human, C-GFPSpark® tag HG10831-ACG
CD163 cDNA ORF Clone, Human, C-OFPSpark® tag HG10831-ACR
CD163 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10831-CF
CD163 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10831-NF
CD163 cDNA ORF Clone, Human, C-His tag HG10831-CH
CD163 cDNA ORF Clone, Human, C-HA tag HG10831-CY
CD163 cDNA ORF Clone, Human, N-HA tag HG10831-NY
CD163 cDNA ORF Clone, Human, C-Myc tag HG10831-CM
CD163 cDNA ORF Clone, Human, N-Myc tag HG10831-NM
CD163 qPCR Primer Pairs, Human HP100920
info info
添加购物车成功! 添加购物车失败!