CD160 cDNA ORF Clone, Human, C-His tag

Cat: HG12191-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD160 Reagents
CRO Services
Product recommended

All CD160 Reagents
CD160 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
591 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CD160 molecule with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Restriction Sites
KpnI + XbaI(6kb+0.59kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CD160 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD160 cDNA ORF Clone, Human, C-His tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5610
CD160 cDNA ORF Clone, Human, C-His tag Alternative Names
BY55 cDNA ORF Clone, Human;NK1 cDNA ORF Clone, Human;NK28 cDNA ORF Clone, Human
CD160 Background Information

CD160 antigen, also known as Natural killer cell receptor BY55 and CD160, is a cell membrane protein which contains one Ig-like V-type (immunoglobulin-like) domain. CD160 is a GPI-anchored lymphocyte surface receptor in which expression is mostly restricted to the highly cytotoxic CD56(dim)CD16(+) peripheral blood NK subset. CD160 is a receptor showing broad specificity for both classical and non-classical MHC class I molecules. CD160 is expressed in spleen, peripheral blood, and small intestine. Expression of CD160 is restricted to functional NK and T cytotoxic lymphocytes. CD160 acts as a co-activator receptor for CD3-induced proliferation of CD4+ CD160+ T cells isolated from inflammatory skin lesions. Unique CD4+ CD160+ lymphocyte subset may play a role in the pathogenesis of skin inflammation. Activated NK lymphocytes release a soluble form of CD160 that functionally impairs the MHC-I-specific cytotoxic CD8(+) T lymphocyte responsiveness.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies   Immune Checkpoint Detection: FCM Antibodies
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
CD160 molecule
References
  • Barakonyi A. et al., 2004, J Immunol.173 (9): 5349-54.
  • Rabot M. et al., 2006, Transpl Immunol. 17 (1): 36-8.
  • Abecassis S. et al., 2007, J Invest Dermatol. 127?(5): 1161-6.
  • Giustiniani J.?et al., 2007, J Immunol. 178 (3): 1293-300.
  • CD160 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD160 cDNA ORF Clone in Cloning Vector, Rhesus CG90224-G
    CD160 cDNA ORF Clone, Rhesus, untagged CG90224-UT
    CD160 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90224-ACG
    CD160 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90224-ACGLN
    CD160 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90224-ACR
    CD160 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90224-CF
    CD160 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90224-NF
    CD160 cDNA ORF Clone, Rhesus, C-His tag CG90224-CH
    CD160 cDNA ORF Clone, Rhesus, N-His tag CG90224-NH
    CD160 cDNA ORF Clone, Rhesus, C-HA tag CG90224-CY
    CD160 cDNA ORF Clone, Rhesus, N-HA tag CG90224-NY
    CD160 cDNA ORF Clone, Rhesus, C-Myc tag CG90224-CM
    CD160 cDNA ORF Clone, Rhesus, N-Myc tag CG90224-NM

    CD160 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD160 cDNA ORF Clone in Cloning Vector, Mouse MG50805-G
    CD160 cDNA ORF Clone, Mouse, untagged MG50805-UT
    CD160 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50805-ACGLN
    CD160 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50805-ACG
    CD160 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50805-ACR
    CD160 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50805-CF
    CD160 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50805-NF
    CD160 cDNA ORF Clone, Mouse, C-His tag MG50805-CH
    CD160 cDNA ORF Clone, Mouse, N-His tag MG50805-NH
    CD160 cDNA ORF Clone, Mouse, C-HA tag MG50805-CY
    CD160 cDNA ORF Clone, Mouse, N-HA tag MG50805-NY
    CD160 cDNA ORF Clone, Mouse, C-Myc tag MG50805-CM
    CD160 cDNA ORF Clone, Mouse, N-Myc tag MG50805-NM
    CD160 qPCR Primer Pairs, Mouse MP200776

    CD160 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD160 cDNA ORF Clone in Cloning Vector, Human HG12191-G
    CD160 cDNA ORF Clone, Human, untagged HG12191-UT
    CD160 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12191-ACGLN
    CD160 cDNA ORF Clone, Human, C-GFPSpark® tag HG12191-ACG
    CD160 cDNA ORF Clone, Human, C-OFPSpark® tag HG12191-ACR
    CD160 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12191-CF
    CD160 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12191-NF
    CD160 cDNA ORF Clone, Human, N-His tag HG12191-NH
    CD160 cDNA ORF Clone, Human, C-HA tag HG12191-CY
    CD160 cDNA ORF Clone, Human, N-HA tag HG12191-NY
    CD160 cDNA ORF Clone, Human, C-Myc tag HG12191-CM
    CD160 cDNA ORF Clone, Human, N-Myc tag HG12191-NM
    CD160 qPCR Primer Pairs, Human HP101821
    info info
    添加购物车成功! 添加购物车失败!