CD109 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG15101-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD109 Reagents
CRO Services
Product recommended

All CD109 Reagents
CD109 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
4377 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CD109 molecule with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI(two restriction sites) + NotI(6kb+0.75kb+3.65kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CD109 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD109 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CPAMD7 cDNA ORF Clone, Human;p180 cDNA ORF Clone, Human;r150 cDNA ORF Clone, Human
CD109 Background Information
Full Name
CD109 molecule

CD109 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CD109 cDNA ORF Clone in Cloning Vector, Rat RG80421-G
CD109 cDNA ORF Clone, Rat, untagged RG80421-UT
CD109 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80421-ACGLN
CD109 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80421-ACG
CD109 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80421-ACR
CD109 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80421-CF
CD109 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80421-NF
CD109 cDNA ORF Clone, Rat, C-His tag RG80421-CH
CD109 cDNA ORF Clone, Rat, N-His tag RG80421-NH
CD109 cDNA ORF Clone, Rat, C-HA tag RG80421-CY
CD109 cDNA ORF Clone, Rat, N-HA tag RG80421-NY
CD109 cDNA ORF Clone, Rat, C-Myc tag RG80421-CM
CD109 cDNA ORF Clone, Rat, N-Myc tag RG80421-NM
CD109 qPCR Primer Pairs, Rat RP300385

CD109 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CD109 cDNA ORF Clone in Cloning Vector, Mouse MG50763-G
CD109 cDNA ORF Clone, Mouse, untagged MG50763-UT
CD109 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50763-ACG
CD109 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50763-ACGLN
CD109 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50763-ACR
CD109 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50763-CF
CD109 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50763-NF
CD109 cDNA ORF Clone, Mouse, C-His tag MG50763-CH
CD109 cDNA ORF Clone, Mouse, N-His tag MG50763-NH
CD109 cDNA ORF Clone, Mouse, C-HA tag MG50763-CY
CD109 cDNA ORF Clone, Mouse, N-HA tag MG50763-NY
CD109 cDNA ORF Clone, Mouse, C-Myc tag MG50763-CM
CD109 cDNA ORF Clone, Mouse, N-Myc tag MG50763-NM
CD109 qPCR Primer Pairs, Mouse MP200737

CD109 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CD109 cDNA ORF Clone in Cloning Vector, Human HG15101-G
CD109 cDNA ORF Clone, Human, untagged HG15101-UT
CD109 cDNA ORF Clone, Human, C-GFPSpark® tag HG15101-ACG
CD109 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15101-ACGLN
CD109 cDNA ORF Clone, Human, C-OFPSpark® tag HG15101-ACR
CD109 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15101-NF
CD109 cDNA ORF Clone, Human, C-His tag HG15101-CH
CD109 cDNA ORF Clone, Human, N-His tag HG15101-NH
CD109 cDNA ORF Clone, Human, C-HA tag HG15101-CY
CD109 cDNA ORF Clone, Human, N-HA tag HG15101-NY
CD109 cDNA ORF Clone, Human, C-Myc tag HG15101-CM
CD109 cDNA ORF Clone, Human, N-Myc tag HG15101-NM
CD109 qPCR Primer Pairs, Human HP103728
info info
添加购物车成功! 添加购物车失败!