After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human Endoglin/CD105 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human ENG cDNA Clone Product Information
NCBI RefSeq:NM_001114753.1
RefSeq ORF Size:1977bp
cDNA Description:Full length Clone DNA of Homo sapiens endoglin (ENG), transcript variant 1 with N terminal Myc tag.
Gene Synonym:Eng, END, ORW, HHT1, ORW1, CD105, FLJ41744
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Endoglin, also known as CD105, is a type I  homodimeric transmembrane glycoprotein with a large, disulfide-linked, extracellular region and a short, constitutively phosphorylated cytoplasmic tail. Endoglin contains an RGD tripeptide which is a key recognition structure in cellular adhesion,,suggesting a critical role for endoglin in the binding of endothelial cells to integrins and/or other RGD receptors. Endoglin is highly expressed on vascular endothelial cells, chondrocytes, and syncytiotrophoblasts of term placenta. It is also found on activated monocytes, mesenchymal stem cells and leukemic cells of lymphoid and myeloid lineages. As an accessory receptor for the TGF-β superfamily ligands, endoglin binds TGF-β1 and TGF-β3 with high affinity not by itself but by associating with TGF-β type I I receptor (TβRII) and activates the downstream signal pathways. In addition, in human umbilical vein endothelial cells, ALK-1 is also a receptor kinase for endoglin threonine phosphorylation, and mutations in either of the two genes result in the autosomal-dominant vascular dysplasia, hereditary hemorrhagic telangiectasia (HHT). Endoglin has been regarded as a powerful biomarker of neovascularization, and is associated with several solid tumor types.

Size / Price
Catalog: HG10149-NM
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"