CCT5/TCP1 epsilon cDNA ORF Clone, Human, untagged

Cat: HG16246-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CCT5/TCP1 epsilon Reagents
CRO Services
Product recommended

All CCT5/TCP1 epsilon Reagents
CCT5/TCP1 epsilon cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1626 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 198A/G,426T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human chaperonin containing TCP1, subunit 5 (epsilon).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI(6.1kb+1.63kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CCT5/TCP1 epsilon cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCT5/TCP1 epsilon cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
CCT5/TCP1 epsilon cDNA ORF Clone, Human, untagged Alternative Names
CCT-epsilon cDNA ORF Clone, Human;CCTE cDNA ORF Clone, Human;HEL-S-69 cDNA ORF Clone, Human;TCP-1-epsilon cDNA ORF Clone, Human
CCT5/TCP1 epsilon Background Information
Full Name
chaperonin containing TCP1, subunit 5 (epsilon)

CCT5/TCP1 epsilon cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CCT5/TCP1 epsilon cDNA ORF Clone in Cloning Vector, Rat RG81231-U
CCT5/TCP1 epsilon cDNA ORF Clone, Rat, untagged RG81231-UT
CCT5/TCP1 epsilon cDNA ORF Clone, Rat, C-GFPSpark® tag RG81231-ACG
CCT5/TCP1 epsilon Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81231-ACGLN
CCT5/TCP1 epsilon cDNA ORF Clone, Rat, N-GFPSpark® tag RG81231-ANG
CCT5/TCP1 epsilon cDNA ORF Clone, Rat, C-OFPSpark® tag RG81231-ACR
CCT5/TCP1 epsilon cDNA ORF Clone, Rat, N-OFPSpark® tag RG81231-ANR
CCT5/TCP1 epsilon cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81231-CF
CCT5/TCP1 epsilon cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81231-NF
CCT5/TCP1 epsilon cDNA ORF Clone, Rat, C-His tag RG81231-CH
CCT5/TCP1 epsilon cDNA ORF Clone, Rat, N-His tag RG81231-NH
CCT5/TCP1 epsilon cDNA ORF Clone, Rat, C-HA tag RG81231-CY
CCT5/TCP1 epsilon cDNA ORF Clone, Rat, N-HA tag RG81231-NY
CCT5/TCP1 epsilon cDNA ORF Clone, Rat, C-Myc tag RG81231-CM
CCT5/TCP1 epsilon cDNA ORF Clone, Rat, N-Myc tag RG81231-NM
CCT5/TCP1 epsilon qPCR Primer Pairs, Rat RP301187

CCT5/TCP1 epsilon cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CCT5/TCP1 epsilon cDNA ORF Clone in Cloning Vector, Mouse MG51270-U
CCT5/TCP1 epsilon cDNA ORF Clone, Mouse, untagged MG51270-UT
CCT5/TCP1 epsilon cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51270-ACG
CCT5/TCP1 epsilon Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51270-ACGLN
CCT5/TCP1 epsilon cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51270-ANG
CCT5/TCP1 epsilon cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51270-ACR
CCT5/TCP1 epsilon cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51270-ANR
CCT5/TCP1 epsilon cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51270-CF
CCT5/TCP1 epsilon cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51270-NF
CCT5/TCP1 epsilon cDNA ORF Clone, Mouse, C-His tag MG51270-CH
CCT5/TCP1 epsilon cDNA ORF Clone, Mouse, N-His tag MG51270-NH
CCT5/TCP1 epsilon cDNA ORF Clone, Mouse, C-HA tag MG51270-CY
CCT5/TCP1 epsilon cDNA ORF Clone, Mouse, N-HA tag MG51270-NY
CCT5/TCP1 epsilon cDNA ORF Clone, Mouse, C-Myc tag MG51270-CM
CCT5/TCP1 epsilon cDNA ORF Clone, Mouse, N-Myc tag MG51270-NM
CCT5/TCP1 epsilon qPCR Primer Pairs, Mouse MP201152

CCT5/TCP1 epsilon cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCT5/TCP1 epsilon cDNA ORF Clone in Cloning Vector, Human HG16246-U
CCT5/TCP1 epsilon Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16246-ACGLN
CCT5/TCP1 epsilon cDNA ORF Clone, Human, C-GFPSpark® tag HG16246-ACG
CCT5/TCP1 epsilon cDNA ORF Clone, Human, N-GFPSpark® tag HG16246-ANG
CCT5/TCP1 epsilon cDNA ORF Clone, Human, C-OFPSpark® tag HG16246-ACR
CCT5/TCP1 epsilon cDNA ORF Clone, Human, N-OFPSpark® tag HG16246-ANR
CCT5/TCP1 epsilon cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16246-CF
CCT5/TCP1 epsilon cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16246-NF
CCT5/TCP1 epsilon cDNA ORF Clone, Human, C-His tag HG16246-CH
CCT5/TCP1 epsilon cDNA ORF Clone, Human, N-His tag HG16246-NH
CCT5/TCP1 epsilon cDNA ORF Clone, Human, C-HA tag HG16246-CY
CCT5/TCP1 epsilon cDNA ORF Clone, Human, N-HA tag HG16246-NY
CCT5/TCP1 epsilon cDNA ORF Clone, Human, C-Myc tag HG16246-CM
CCT5/TCP1 epsilon cDNA ORF Clone, Human, N-Myc tag HG16246-NM
CCT5/TCP1 epsilon qPCR Primer Pairs, Human HP105010
info info
添加购物车成功! 添加购物车失败!