Cyclin E cDNA ORF Clone, Human, N-Myc tag

Cat: HG10902-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cyclin E Reagents
CRO Services
Product recommended

All Cyclin E Reagents
Cyclin E cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1233 bp
Description
Full length Clone DNA of Human cyclin E1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cyclin E cDNA ORF Clone, Human, N-Myc tag Alternative Names
CCNE cDNA ORF Clone, Human
Cyclin E Background Information

Cyclin E1 is a member of the highly conserved cyclin family and belongs to the E-type cyclin that functions as a regulator of S phase entry and progression in mammalian cells. Cyclin E1 serves as regulatory subunits that bind, activate, and provide substrate for its associated cyclin-dependent kinase2 (CDK2), whose activity is essential for cell cycle G1 / S transition. Over expression of this encoding gene has been found in many tumors, which results in chromosome instability and by extension, induce tumorigenesis. This protein was also found to associate with, and be involved in, the phosphorylation of NPAT protein (nuclear protein mapped to the ATM locus), which participates in cell-cycle regulated histone gene expression and plays a critical role in promoting cell-cycle progression in the absence of pRB. In general, cyclin E1, as an activator of phospho-CDK2 (pCDK2), is important for cell cycle progression and is frequently overexpressed in cancer cells.

Full Name
cyclin E1
References
  • Honda R, et al. (2005) The structure of cyclin E1 / CDK2: implications for CDK2 activation and CDK2-independent roles. The EMBO Journal. 24: 452-63.
  • Geng Y, et al. (2007) Kinase-Independent Function of Cyclin E. 25(1): 127-39.
  • Cyclin E cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Cyclin E cDNA ORF Clone in Cloning Vector, Mouse MG50896-G
    Cyclin E cDNA ORF Clone, Mouse, untagged MG50896-UT
    Cyclin E Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50896-ACGLN
    Cyclin E cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50896-ACG
    Cyclin E cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50896-ANG
    Cyclin E cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50896-ACR
    Cyclin E cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50896-ANR
    Cyclin E cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50896-CF
    Cyclin E cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50896-NF
    Cyclin E cDNA ORF Clone, Mouse, C-His tag MG50896-CH
    Cyclin E cDNA ORF Clone, Mouse, N-His tag MG50896-NH
    Cyclin E cDNA ORF Clone, Mouse, C-HA tag MG50896-CY
    Cyclin E cDNA ORF Clone, Mouse, N-HA tag MG50896-NY
    Cyclin E cDNA ORF Clone, Mouse, C-Myc tag MG50896-CM
    Cyclin E cDNA ORF Clone, Mouse, N-Myc tag MG50896-NM
    Cyclin E qPCR Primer Pairs, Mouse MP200867

    Cyclin E cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Cyclin E cDNA ORF Clone in Cloning Vector, Human HG10902-M
    Cyclin E cDNA ORF Clone, Human, untagged HG10902-UT
    Cyclin E cDNA ORF Clone, Human, C-GFPSpark® tag HG10902-ACG
    Cyclin E Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10902-ACGLN
    Cyclin E cDNA ORF Clone, Human, N-GFPSpark® tag HG10902-ANG
    Cyclin E cDNA ORF Clone, Human, C-OFPSpark® tag HG10902-ACR
    Cyclin E cDNA ORF Clone, Human, N-OFPSpark® tag HG10902-ANR
    Cyclin E cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10902-CF
    Cyclin E cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10902-NF
    Cyclin E cDNA ORF Clone, Human, C-His tag HG10902-CH
    Cyclin E cDNA ORF Clone, Human, N-His tag HG10902-NH
    Cyclin E cDNA ORF Clone, Human, C-HA tag HG10902-CY
    Cyclin E cDNA ORF Clone, Human, N-HA tag HG10902-NY
    Cyclin E cDNA ORF Clone, Human, C-Myc tag HG10902-CM
    Cyclin E qPCR Primer Pairs, Human HP100786
    info info
    添加购物车成功! 添加购物车失败!