Cyclin A2 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10906-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cyclin A2 Reagents
CRO Services
Product recommended

All Cyclin A2 Reagents
Cyclin A2 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1299 bp
Description
Full length Clone DNA of Human cyclin A2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cyclin A2 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CCN1 cDNA ORF Clone, Human;CCNA cDNA ORF Clone, Human
Cyclin A2 Background Information
Full Name
cyclin A2

Cyclin A2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cyclin A2 cDNA ORF Clone in Cloning Vector, Mouse MG50908-G
Cyclin A2 cDNA ORF Clone, Mouse, untagged MG50908-UT
Cyclin A2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50908-ACG
Cyclin A2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50908-ACGLN
Cyclin A2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50908-ANG
Cyclin A2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50908-ACR
Cyclin A2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50908-ANR
Cyclin A2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50908-CF
Cyclin A2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50908-NF
Cyclin A2 cDNA ORF Clone, Mouse, C-His tag MG50908-CH
Cyclin A2 cDNA ORF Clone, Mouse, N-His tag MG50908-NH
Cyclin A2 cDNA ORF Clone, Mouse, C-HA tag MG50908-CY
Cyclin A2 cDNA ORF Clone, Mouse, N-HA tag MG50908-NY
Cyclin A2 cDNA ORF Clone, Mouse, C-Myc tag MG50908-CM
Cyclin A2 cDNA ORF Clone, Mouse, N-Myc tag MG50908-NM

Cyclin A2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cyclin A2 cDNA ORF Clone in Cloning Vector, Human HG10906-G
Cyclin A2 cDNA ORF Clone, Human, untagged HG10906-UT
Cyclin A2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10906-ACGLN
Cyclin A2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10906-ACG
Cyclin A2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10906-ANG
Cyclin A2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10906-ACR
Cyclin A2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10906-ANR
Cyclin A2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10906-CF
Cyclin A2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10906-NF
Cyclin A2 cDNA ORF Clone, Human, C-His tag HG10906-CH
Cyclin A2 cDNA ORF Clone, Human, N-His tag HG10906-NH
Cyclin A2 cDNA ORF Clone, Human, C-HA tag HG10906-CY
Cyclin A2 cDNA ORF Clone, Human, N-HA tag HG10906-NY
Cyclin A2 cDNA ORF Clone, Human, C-Myc tag HG10906-CM
Cyclin A2 qPCR Primer Pairs, Human HP100790
info info
添加购物车成功! 添加购物车失败!