Quick Order

Human Cyclin A1/CCNA1 Gene ORF cDNA clone expression plasmid, C-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Human CCNA1 cDNA Clone Product Information
    NCBI RefSeq:NM_003914.3
    RefSeq ORF Size:1398bp
    cDNA Description:Full length Clone DNA of Human cyclin A1 with C terminal Flag tag.
    Gene Synonym:CCNA1
    Restriction Site:
    Sequence Description:
    Sequencing primers:T7( 5' TAATACGACTCACTATAGGG 3' )
    ( We provide with CCNA1 qPCR primers for gene expression analysis, HP100070 )
    Promoter:Enhanced CMV cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name

    Cyclin A1 is a member of the highly conserved cyclin family that is characterized by a dramatic periodicity in protein abundance, and belongs to the A-type cyclin subfamily. The mammalian A-type cyclin family consists of two members: cyclin A1 and cyclin A2. Different cyclins exhibit distinct expression. Cyclin A1 is expressed in mice exclusively in the germ cell lineage and high rate of cyclinA1 is found in human testis and certain myeloid leukaemia cells. Cyclin A1 is primarily function in the control of meiosis. It serves as regulator subunits binding to cyclin-dependent kinase 1 (Cdk1) and cyclin-dependent kinase 2 (Cdk2), which give two different kinase activities, one appearing in S phase, the other in G2. Through this, cyclin A1 operate the entry and progression in cell cycle. High frequency of cyclin A1 overexpression has been observed in acute myelocytic leukemias, especially those that are at the promyelocyte and myeloblast stages of development.

  • Yang R, et al. (1999) Functions of Cyclin A1 in the cell cycle and its interactions with transcription factor E2F-1 and the Rb family of proteins. Molecular and Cellular biology. 19 (3): 2400-7.
  • Yang R, et al. (1999) Cyclin A1 expression in leukemia and normal hematopoietic cells. Blood. 93 (6): 2067-74.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.