CCL27 cDNA ORF Clone, Human, C-HA tag

Cat: HG10625-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CCL27 Reagents
CRO Services
Product recommended

All CCL27 Reagents
CCL27 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
339 bp
Description
Full length Clone DNA of Human chemokine (C-C motif) ligand 27 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCL27 cDNA ORF Clone, Human, C-HA tag Alternative Names
ALP cDNA ORF Clone, Human;CCL27 cDNA ORF Clone, Human;CTACK cDNA ORF Clone, Human;CTAK cDNA ORF Clone, Human;ESKINE cDNA ORF Clone, Human;ILC cDNA ORF Clone, Human;PESKY cDNA ORF Clone, Human;SCYA27 cDNA ORF Clone, Human
CCL27 Background Information

CCL27, also known as CTACK, is a small cytokine belonging to the CC chemokine family. Members of this family are proteins characterized by two adjacent cysteines. CCL27 is chemotactic for skin-associated memory T lymphocytes. CCL27 may also play a role in mediating homing of lymphocytes to cutaneous sites. CCL27 plays a pivotal role in establishing the inflammatory infiltrate characteristic for common inflammatory skin diseases. Through binding to the chemokine receptor 10 (CCR10), CCL27 mediates inflammation by promoting lymphocyte migration into the skin.

Full Name
chemokine (C-C motif) ligand 27
References
  • Morales. et al., 1999, Proc Natl Acad Sci. 96: 14470-5.
  • Homey. et al., 2002, J Immunol. 164: 3465-70.
  • Ishikawa-Mochizuki. et al., 1999, FEBS Lett. 460: 544-8.
  • CCL27 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CCL27 cDNA ORF Clone in Cloning Vector, Rat RG80085-G
    CCL27 cDNA ORF Clone, Rat, untagged RG80085-UT
    CCL27 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80085-ACG
    CCL27 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80085-ACGLN
    CCL27 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80085-ACR
    CCL27 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80085-CF
    CCL27 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80085-NF
    CCL27 cDNA ORF Clone, Rat, C-His tag RG80085-CH
    CCL27 cDNA ORF Clone, Rat, N-His tag RG80085-NH
    CCL27 cDNA ORF Clone, Rat, C-HA tag RG80085-CY
    CCL27 cDNA ORF Clone, Rat, N-HA tag RG80085-NY
    CCL27 cDNA ORF Clone, Rat, C-Myc tag RG80085-CM
    CCL27 cDNA ORF Clone, Rat, N-Myc tag RG80085-NM
    CCL27 qPCR Primer Pairs, Rat RP300081

    CCL27 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CCL27 cDNA ORF Clone in Cloning Vector, Human HG10625-M
    CCL27 cDNA ORF Clone, Human, untagged HG10625-UT
    CCL27 cDNA ORF Clone, Human, C-GFPSpark® tag HG10625-ACG
    CCL27 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10625-ACGLN
    CCL27 cDNA ORF Clone, Human, C-OFPSpark® tag HG10625-ACR
    CCL27 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10625-CF
    CCL27 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10625-NF
    CCL27 cDNA ORF Clone, Human, C-His tag HG10625-CH
    CCL27 cDNA ORF Clone, Human, N-His tag HG10625-NH
    CCL27 cDNA ORF Clone, Human, N-HA tag HG10625-NY
    CCL27 cDNA ORF Clone, Human, C-Myc tag HG10625-CM
    CCL27 cDNA ORF Clone, Human, N-Myc tag HG10625-NM
    CCL27 qPCR Primer Pairs, Human HP100605

    CCL27 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CCL27 qPCR Primer Pairs, Mouse MP200369
    info info
    添加购物车成功! 添加购物车失败!