CCL26/Eotaxin-3 cDNA ORF Clone, Human, N-HA tag

Cat: HG10577-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CCL26/Eotaxin-3 Reagents
CRO Services
Product recommended

All CCL26/Eotaxin-3 Reagents
CCL26/Eotaxin-3 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
285 bp
Description
Full length Clone DNA of Human chemokine (C-C motif) ligand 26 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCL26/Eotaxin-3 cDNA ORF Clone, Human, N-HA tag Alternative Names
IMAC cDNA ORF Clone, Human;MIP-4a cDNA ORF Clone, Human;MIP-4alpha cDNA ORF Clone, Human;SCYA26 cDNA ORF Clone, Human;TSC-1 cDNA ORF Clone, Human
CCL26/Eotaxin-3 Background Information

The eotaxin subfamily of CC chemokines consists of eotaxin-1/CCL11, eotaxin-2/CCL24 and eotaxin-3/CCL26. All eotaxins induce the trafficking of eosinophils to the sites of inflammation via CC chemokine receptor 3 (CCR3), which is also expressed by several different cell types, including basophils, dendritic cells, smooth muscle cells, epithelial cells and fibroblasts. The sequence similarity between the three eotaxins is limited (<40%), but their functional properties are very similar. Eotaxin-1 and -2 are expressed by both haematopoietic and non-haematopoietic cells, but eotaxin-3 expression has been reported to be limited to non-haematopoietic cells. Interleukin (IL)-4 is the main inducer for eotaxin-3 expression, whereas eotaxin-1 is up-regulated by IL-4 and the proinflammatory cytokine tumour necrosis factor (TNF)-α. Eotaxin-3 is expressed in vascular endothelial cells and human dermal fibroblasts after IL-4 and IL-13 stimulation, and this is dependent upon the IL-4-/IL-13-specific transcription factor, signal transducers and activator of transcription (STAT)-6. Eotaxin-3 is expressed on the surface of IL-4-stimulated endothelial cells and promotes eosinophil transmigration.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
chemokine (C-C motif) ligand 26
References
  • Takahashi K, Imaeda H, Fujimoto T, et al. Regulation of eotaxin-3/CC chemokine ligand 26 expression by T helper type 2 cytokines in human colonic myofibroblasts. Clinical and Experimental Immunology. 2013;173(2):323-331.
  • CCL26/Eotaxin-3 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    CCL26/Eotaxin-3 cDNA ORF Clone in Cloning Vector, Canine DG70056-G
    CCL26/Eotaxin-3 cDNA ORF Clone, Canine, untagged DG70056-UT
    CCL26/Eotaxin-3 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70056-ACG
    CCL26/Eotaxin-3 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70056-ACGLN
    CCL26/Eotaxin-3 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70056-ACR
    CCL26/Eotaxin-3 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70056-CF
    CCL26/Eotaxin-3 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70056-NF
    CCL26/Eotaxin-3 cDNA ORF Clone, Canine, C-His tag DG70056-CH
    CCL26/Eotaxin-3 cDNA ORF Clone, Canine, N-His tag DG70056-NH
    CCL26/Eotaxin-3 cDNA ORF Clone, Canine, C-HA tag DG70056-CY
    CCL26/Eotaxin-3 cDNA ORF Clone, Canine, N-HA tag DG70056-NY
    CCL26/Eotaxin-3 cDNA ORF Clone, Canine, C-Myc tag DG70056-CM
    CCL26/Eotaxin-3 cDNA ORF Clone, Canine, N-Myc tag DG70056-NM

    CCL26/Eotaxin-3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CCL26/Eotaxin-3 cDNA ORF Clone in Cloning Vector, Human HG10577-M
    CCL26/Eotaxin-3 cDNA ORF Clone, Human, untagged HG10577-UT
    CCL26/Eotaxin-3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10577-ACGLN
    CCL26/Eotaxin-3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10577-ACG
    CCL26/Eotaxin-3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10577-ACR
    CCL26/Eotaxin-3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10577-CF
    CCL26/Eotaxin-3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10577-NF
    CCL26/Eotaxin-3 cDNA ORF Clone, Human, C-His tag HG10577-CH
    CCL26/Eotaxin-3 cDNA ORF Clone, Human, N-His tag HG10577-NH
    CCL26/Eotaxin-3 cDNA ORF Clone, Human, C-HA tag HG10577-CY
    CCL26/Eotaxin-3 cDNA ORF Clone, Human, C-Myc tag HG10577-CM
    CCL26/Eotaxin-3 cDNA ORF Clone, Human, N-Myc tag HG10577-NM
    CCL26/Eotaxin-3 qPCR Primer Pairs, Human HP100584
    info info
    添加购物车成功! 添加购物车失败!